LN-229 cell line with low expression of human phosphatase and tensin homolog (PTEN) protein and construction method for LN-229 cell line
A low-expression technology of LN-229, applied in the field of biomedicine, can solve the problems of cell damage, lack of stable, high-efficiency and low-expression PTEN cell line models, and low transfection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0021] 1. Lentiviral infection and cell line screening
[0022] 1) The lentiviral packaging cells 293T were inoculated on a 60 mm cell culture dish containing DMEM high-glucose medium one day before transfection so that the cell density reached 60%-70% the next day.
[0023] 2) Transfect 5 μg of packaging plasmid pVSVg, viral plasmid PSPAX2 and shRNA at a concentration ratio of 1:8:9 in each culture dish containing 293T cells. There are 3 different shRNA knockout fragments sh1, sh2, sh3 and blank control control, totally four kinds, which were respectively transfected into 293T cells, in order to obtain 4 kinds of lentiviral packaging plasmids.
[0024] Sequence of shPTEN Fragment 1 (sh1):
[0025] CCGGAGGCGCTATGTGTATTATTATCTCGAGATAATAATACACATAGCGCCTTTTTT
[0026] Sequence of shPTEN Fragment 2 (sh2):
[0027] CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG
[0028] Sequence of shPTEN Fragment 3 (sh3):
[0029] CCGGCGTGCAGATAATGACAAGGAACTCGAGTTCCTTGTCATTATCTGCAC...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap