Unlock instant, AI-driven research and patent intelligence for your innovation.

LN-229 cell line with low expression of human phosphatase and tensin homolog (PTEN) protein and construction method for LN-229 cell line

A low-expression technology of LN-229, applied in the field of biomedicine, can solve the problems of cell damage, lack of stable, high-efficiency and low-expression PTEN cell line models, and low transfection efficiency

Inactive Publication Date: 2020-03-31
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] To study the molecular mechanism of PTEN, it is necessary to construct a cell line with stable and low expression of PTEN as a cell model, but there is currently a lack of cell line models with stable, high, high and low expression of PTEN in glioma
The construction of low-expression cell lines mainly relies on the physical or chemical transfer of the target shRNA into cells. This method has disadvantages such as low transfection efficiency and damage to cells.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LN-229 cell line with low expression of human phosphatase and tensin homolog (PTEN) protein and construction method for LN-229 cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0021] 1. Lentiviral infection and cell line screening

[0022] 1) The lentiviral packaging cells 293T were inoculated on a 60 mm cell culture dish containing DMEM high-glucose medium one day before transfection so that the cell density reached 60%-70% the next day.

[0023] 2) Transfect 5 μg of packaging plasmid pVSVg, viral plasmid PSPAX2 and shRNA at a concentration ratio of 1:8:9 in each culture dish containing 293T cells. There are 3 different shRNA knockout fragments sh1, sh2, sh3 and blank control control, totally four kinds, which were respectively transfected into 293T cells, in order to obtain 4 kinds of lentiviral packaging plasmids.

[0024] Sequence of shPTEN Fragment 1 (sh1):

[0025] CCGGAGGCGCTATGTGTATTATTATCTCGAGATAATAATACACATAGCGCCTTTTTT

[0026] Sequence of shPTEN Fragment 2 (sh2):

[0027] CCGGACATTATGACACCGCCAAATTCTCGAGAATTTGGCGGTGTCATAATGTTTTTTG

[0028] Sequence of shPTEN Fragment 3 (sh3):

[0029] CCGGCGTGCAGATAATGACAAGGAACTCGAGTTCCTTGTCATTATCTGCAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method for a LN-229 cell line with low expression of phosphatase and tensin homolog (PTEN). The stable LN-229 cell line with low expression of PTEN is constructed by utilizing a lentivirus system; shPTEN and lentivirus packaging plasmids are transfected into HEK293T cells; a virus supernatant is collected to infect LN-229 cells; the transfected LN-229 cellsare screened with puromycin to obtain the stable LN-229 cell line with low expression of PTEN; and finally, tested by a Western blot technique, the expression of PTEN of cell strains is decreased by more than 80%, and thus, the cell line with low expression of PTEN is successfully constructed. The cell line can serve as an ideal cell line for researching the molecular action mechanism and the participating metabolic regulation effect of PTEN in glioma.

Description

technical field [0001] The invention relates to the construction of an LN-229 cell line stably and lowly expressing PTEN protein and a construction method thereof, and relates to the field of biomedicine. Background technique [0002] PTEN catalyzes the dephosphorylation of PtdIns(3,4,5)P3. PTEN loss occurs in a variety of tumors, and PTEN loss exists in about 75% of gliomas. Glioma patients with PTEN deletion generally have a shorter survival period. Therefore, the study of PTEN is of great significance to the study of new tumor markers and marker proteins of cell metabolism disorders in glioma, and it can also be used for adjuvant treatment such as early clinical diagnosis and prognosis judgment of glioma. [0003] Studying the molecular mechanism of PTEN requires the construction of stable and low-expression cell lines of PTEN as cell models, but there is currently a lack of cell line models with stable, high-efficiency and low-expression of PTEN in glioma. The constru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/867
CPCC12N5/0693C12N15/86C12N2740/15043C12N2510/02
Inventor 朴海龙王志超许国旺路鑫
Owner DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More