Check patentability & draft patents in minutes with Patsnap Eureka AI!

Anti-CD123 humanized single-chain antibody and application thereof

A single-chain antibody and antigen technology, applied in the field of genetic engineering, can solve the problem of antibodies losing antigen-binding activity and achieve the effects of enhancing persistence, safety, good stability, and reducing immunogenicity

Active Publication Date: 2020-04-03
CHONGQING PRECISION BIOTECH CO LTD
View PDF10 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the transformation of antibodies usually leads to the loss of the original antigen-binding activity of the antibody. Therefore, it is necessary to repeatedly modify the key residues that affect the binding of antigens and antibodies, and then screen a large number of antigen-antibody binding specificity and affinity tests to obtain active antibody sequences.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CD123 humanized single-chain antibody and application thereof
  • Anti-CD123 humanized single-chain antibody and application thereof
  • Anti-CD123 humanized single-chain antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: Design of humanized monoclonal antibodies against human CD123 antigen

[0047] (1) The amino acid sequences of the 6 FR regions of the light and heavy chains of the mouse anti-human CD123 monoclonal antibody were analyzed and compared through the IMGT / BLAST database, and the human antibody sequence with the highest homology was selected as the transformation template. Three humanized scFv were obtained, named 12-1h1, 12-1h2 and 12-1h3, and the amino acid sequences are shown in the following table:

[0048] Table 1: Obtained humanized scFv sequences

[0049]

[0050] It has been verified that although the CAR constructed by humanized scFv can be normally expressed on the surface of T cells, none of them can work normally, while the CAR of the mouse-derived unmodified scFv combination can work normally, recognize and kill tumor cells expressing CD123; therefore, human The derivation-modified scFv has functional defects, the results are as follows figure 1 ...

Embodiment 2

[0052] Example 2. Expression and purification of humanized monoclonal antibody targeting CD123

[0053] The plasmid carrying the monoclonal antibody was used to construct a lentiviral expression system, and the CHO expression cells were infected by virus infection, and the monoclonal cell lines with high scFv expression were screened, and the cell expression supernatant was collected every three days. The expressed scFv carries a His tag, and the His tag protein is used for purification. The collected cell supernatant was purified using the AKTA Prime instrument. The purification was divided into two steps: NTA-Ni+ affinity chromatography and gel chromatography. For specific experimental steps, refer to the AKTA Prime manual. The purified protein was verified by Western blot to verify the activity and purity of scFv, such as Figure 4 As shown, the four modified scFvs all have activity and high purity.

[0054] Example 2, Affinity Determination of Humanized Monoclonal Antibo...

Embodiment 3

[0056] Example 3. Preparation of Lentivirus Expressing a Chimeric Antigen Receptor Targeting Human CD123 Antigen

[0057] (1) Prepare the gene sequence of the chimeric antigen receptor targeting human CD123 antigen

[0058] Synthesize chimeric antigen receptor sequence containing leader peptide (also known as signal peptide), anti-human CD123 antigen single-chain antibody ScFv, hFc hinge region, transmembrane region and intracellular signal segment in sequence, its structure is as follows Figure 6 shown. The nucleotide sequence of the leader peptide is atgggatggagctgtatcatcctcttcctggtagcaacagctacaggcgtgcacagt; the nucleotide sequence of the humanized single-chain antibody against human CD123 antigen is shown in SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:16 shown; the nucleotide sequence of the hFc hinge region is an amino acid sequence such as the amino acid sequence corresponding to SEQ ID NO.17 or SEQ ID NO:18 or SEQ ID NO:19 or SEQ ID NO:20; the transmembrane...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and particularly relates to an anti-CD123 humanized single-chain antibody and an application thereof. The light-chain amino acid sequences of the single-chain antibody for identifying a CD123 antigen are shown as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7. The heavy chain amino acid sequences of the single-chain antibody are shown as SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8. The invention provides a stable and suitable anti-CD123 humanized single-chain antibody (scFv) which is used for preparing a CAR structure. The binding specificity and affinity of the scFv are reserved, and the stability and safety of CAR-T in vivo are guaranteed. After expression in immune cells, not only can tumor target cells expressing the CD123 antigen be effectively removed, but also no toxic effect is caused to tumor cells expressing a negative antigen (not expressing CD123). Moreover, the positive rate of the CD123-targeting CAR in the cell culture process of a patient can be maintained, and the CD123-targeting CAR can be proliferated for a long time after being stimulated by a target antigen and can be used for targeting treatment of tumors.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to an anti-CD123 humanized single-chain antibody and its application. Background technique [0002] CD123, also known as interleukin-3 receptor α chain (IL-3Rα), is highly expressed in leukemia stem cells or leukemia immature cells, and is not or lowly expressed in normal hematopoietic stem cells. It is a leukemia-associated antigen and a specific antigen for acute myeloid leukemia. Acute myeloid leukemia (AML) is a malignant disease of myeloid hematopoietic stem / progenitor cells, characterized by abnormal proliferation of primitive and immature myeloid cells in bone marrow and peripheral blood. Timely treatment is often life-threatening; although conventional induction chemotherapy can alleviate AML, it cannot prevent the recurrence of AML and the high mortality rate of relapsed patients. However, the conventional treatment of AML has not changed for 50 years, and it...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C07K19/00C12N15/13C12N5/09C12N5/10C12N15/867A61K39/395A61K35/17A61P35/02
CPCC07K16/2866A61K35/17A61P35/02C07K2317/622A61K2039/505C07K2317/21
Inventor 张巍陈军单娟娟赵文旭徐艳敏黄霞赵永春张茜真
Owner CHONGQING PRECISION BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More