Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene ed1 Controlling Plant Height of Rapeseed and Its Application

A gene and technology of rapeseed, applied in the field of gene ED1 and its application in rapeseed dwarf molecular breeding, can solve the problems of few reports, lagging research on dwarf stem mutation resources of rapeseed, etc.

Active Publication Date: 2022-02-18
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the utilization of rapeseed dwarf mutation resources and the research on the mechanism of dwarf stems are lagging behind, and there are few related reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene ed1 Controlling Plant Height of Rapeseed and Its Application
  • Gene ed1 Controlling Plant Height of Rapeseed and Its Application
  • Gene ed1 Controlling Plant Height of Rapeseed and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Controlling the Acquisition of Rapeseed Plant Height Gene ED1

[0020] 1. Rapeseed dwarf mutant ed1

[0021] The high-stalk variety N370 was used as the female parent and the extremely short-stalked material ed1 was used as the male parent for hybridization. The harvested seeds were F1, and N370, ed1 and F1 were planted at the same time. When the plants matured, the agronomic traits were counted, as shown in Table 1. Statistics show that ed1 can effectively lower the stems of high stem varieties, and the plant height of F1 is only about 36% of the tall stem varieties.

[0022] Table 1 Agronomic phenotypes of parental plants and first generation hybrids

[0023]

[0024] 2. Development of gene ED1

[0025] Taking Brassica napus short-stem mutant ed1 as the research object, construct F2 fine-mapping population with tall-stem parent Y96; use 60k SNP chip combined with GWAS to initially locate the gene, and then perform transcriptome sequencing on ed1 and Y96...

Embodiment 2

[0026] Example 2 Using the 35S promoter to obtain the extremely dwarf material 35S-ED1

[0027] 1. Extraction of plant total RNA

[0028] In this experiment, the total plant RNA extraction kit from Takara Company was used. The mortar and spoon used in the experiment were wiped with 95% ethanol and treated at high temperature. The pipette tip and centrifuge tube were RNase-Free products specially used for RNA extraction. The specific operation steps are as follows:

[0029] (1) Add 450 μL RL and 9 μL 50×DTT to a 2.0 mL centrifuge tube;

[0030] (2) Add liquid nitrogen and an appropriate amount of fresh ed1 rape leaves into the mortar, grind them quickly to prevent freezing and thawing, and add the sample powder to the centrifuge tube prepared in the previous step. The sample powder amount is preferably between 0.03 and 0.1g ;

[0031] (3) After shaking and mixing, centrifuge at 11500 rpm for 4 minutes at 4°C;

[0032] (4) Transfer the supernatant into a 1.5mL centrifuge tub...

Embodiment 3

[0077] Example 3 Using its own promoter to obtain dwarf material PIAA7-C5-ED1

[0078] 1. Extraction of DNA

[0079] In this study, the Plant DNA Extraction Kit of Ai Sijin Company was used, and the extraction steps were referred to the instructions.

[0080] 2. Promoter amplification

[0081] (1) Promoter primer sequence:

[0082] PIAA7-C5-F (5′-3′): gaaaccgataggaaatacaag

[0083] PIAA7-C5-R(3′-5′):ctataatctattacaggtaac

[0084] (2) Use KOD-Neo-Plus high-fidelity enzyme to perform PCR amplification on the target gene. The reaction system is as follows:

[0085]

[0086] (3) After mixing the system, carry out PCR according to the following procedure: pre-denaturation at 98°C for 3 minutes; then denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 120 s, 35 cycles; storage at 4°C;

[0087] 3. Digestion of vector pCAMBIA3301

[0088]

[0089] Electrophoresis, gel cutting and recovery.

[0090] 4. Multi-fragment recombination

[0091] Use...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene controlling the plant height of rapeseed ED1 and its application in the breeding of rapeseed dwarf varieties. Cloning of Mutated Genes Related to Plant Height from Rapeseed Rapeseed Extremely Dwarf Mutant Strain ed1 by Fine Mapping ED1 , the gene is located on chromosome C5, and the gene BnaIAA7 compared to gene ED1 Contains a missense base mutation, that is, there is a C to T substitution at sequence 260. Gene expression in plant expression vectors ED1 Transformed into rapeseed, it can efficiently and accurately reduce the stems of rapeseed varieties, and its own promoter drives the gene ED1 , the plant height of heterozygous plants decreased by 34%, and the plant height of homozygous plants decreased by 80%; when the gene ED1 When driven by the 35S promoter, the plant height of heterozygous lines will be reduced by 74%, and the plant height of homozygous lines will be reduced by 89%.

Description

technical field [0001] The invention belongs to the field of plant molecular breeding, and in particular relates to a gene ED1 for controlling plant height of rapeseed and its application in molecular breeding of rapeseed dwarf. Background technique [0002] my country's four major oil crops include rapeseed, soybeans, peanuts and sunflowers, with rapeseed topping the list. Rapeseed is also the fifth largest crop after rice, wheat, corn and soybean in my country and the largest source of domestic edible oil. Rapeseed oil is a traditional edible oil in China, accounting for about 57% of the oil produced by domestic oil crops (Wang Hanzhong, 2010). Since the founding of the People's Republic of China, my country's rapeseed production has successfully realized three major leaps and achieved remarkable achievements. However, my country's rapeseed production still lags behind Canada and other countries. Therefore, increasing the production of oilseed rape is a major goal for t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/04A01H6/20
CPCC07K14/415C12N15/8261
Inventor 华玮郑明浦惠明胡茂龙杨红丽张亮
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI