Gene ed1 Controlling Plant Height of Rapeseed and Its Application
A gene and technology of rapeseed, applied in the field of gene ED1 and its application in rapeseed dwarf molecular breeding, can solve the problems of few reports, lagging research on dwarf stem mutation resources of rapeseed, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Controlling the Acquisition of Rapeseed Plant Height Gene ED1
[0020] 1. Rapeseed dwarf mutant ed1
[0021] The high-stalk variety N370 was used as the female parent and the extremely short-stalked material ed1 was used as the male parent for hybridization. The harvested seeds were F1, and N370, ed1 and F1 were planted at the same time. When the plants matured, the agronomic traits were counted, as shown in Table 1. Statistics show that ed1 can effectively lower the stems of high stem varieties, and the plant height of F1 is only about 36% of the tall stem varieties.
[0022] Table 1 Agronomic phenotypes of parental plants and first generation hybrids
[0023]
[0024] 2. Development of gene ED1
[0025] Taking Brassica napus short-stem mutant ed1 as the research object, construct F2 fine-mapping population with tall-stem parent Y96; use 60k SNP chip combined with GWAS to initially locate the gene, and then perform transcriptome sequencing on ed1 and Y96...
Embodiment 2
[0026] Example 2 Using the 35S promoter to obtain the extremely dwarf material 35S-ED1
[0027] 1. Extraction of plant total RNA
[0028] In this experiment, the total plant RNA extraction kit from Takara Company was used. The mortar and spoon used in the experiment were wiped with 95% ethanol and treated at high temperature. The pipette tip and centrifuge tube were RNase-Free products specially used for RNA extraction. The specific operation steps are as follows:
[0029] (1) Add 450 μL RL and 9 μL 50×DTT to a 2.0 mL centrifuge tube;
[0030] (2) Add liquid nitrogen and an appropriate amount of fresh ed1 rape leaves into the mortar, grind them quickly to prevent freezing and thawing, and add the sample powder to the centrifuge tube prepared in the previous step. The sample powder amount is preferably between 0.03 and 0.1g ;
[0031] (3) After shaking and mixing, centrifuge at 11500 rpm for 4 minutes at 4°C;
[0032] (4) Transfer the supernatant into a 1.5mL centrifuge tub...
Embodiment 3
[0077] Example 3 Using its own promoter to obtain dwarf material PIAA7-C5-ED1
[0078] 1. Extraction of DNA
[0079] In this study, the Plant DNA Extraction Kit of Ai Sijin Company was used, and the extraction steps were referred to the instructions.
[0080] 2. Promoter amplification
[0081] (1) Promoter primer sequence:
[0082] PIAA7-C5-F (5′-3′): gaaaccgataggaaatacaag
[0083] PIAA7-C5-R(3′-5′):ctataatctattacaggtaac
[0084] (2) Use KOD-Neo-Plus high-fidelity enzyme to perform PCR amplification on the target gene. The reaction system is as follows:
[0085]
[0086] (3) After mixing the system, carry out PCR according to the following procedure: pre-denaturation at 98°C for 3 minutes; then denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 120 s, 35 cycles; storage at 4°C;
[0087] 3. Digestion of vector pCAMBIA3301
[0088]
[0089] Electrophoresis, gel cutting and recovery.
[0090] 4. Multi-fragment recombination
[0091] Use...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


