Primer, kit and method for detecting PAH gene mutation
A kit, the technology of PAH-6F, which is applied in the fields of life science and biology, can solve the problems of unclear mechanism affecting RNA splicing and PAH activity, so as to reduce cost and difficulty, reduce the amount of samples and reagents used, and reduce detection cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Primers for detecting mutations in exons 6 and 7 of the PAH gene, which are amplification primers specifically designed for exons 6 and 7 of the PAH gene:
[0040] A kit for detecting mutations in exons 6 and 7 of the PAH gene, including
[0041] (i) blood / tissue DNA extraction reagents;
[0042] (ii) detection system PCR reaction solution;
[0043] (iii) Sequencing system reagents;
[0044] (iv) Positive control substance and negative control substance.
[0045] Among them, blood / tissue DNA extraction reagents can be purchased from commercial reagents such as Tiangen DNA Extraction Kit.
[0046] Detection system PCR amplification reaction solution includes: 2×PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U / μl); PAH-6F (10μM), PAH-6R (10μM), PAH-7F (10μM), PAH-7R (10 μM).
[0047] PAH-6F:TGTAAAACGACGGCCAGTCCCGACTCCCTCTGCTAA
[0048] PAH-6R:AACAGCTATGACCATGGCCTCAATCCTCCCCCAA
[0049] PAH-7F: TGTAAAACGACGGCCAGTCTATGTCCCTGGGCAGTTATG
[0050]PAH-7R:AACAGCTATGACCATG...
Embodiment 2
[0055] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):
[0056] (1) Extract tissue DNA from blood:
[0057] 1) Take 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed.
[0058] 2) Add 20 μl proteinase K solution and mix well.
[0059] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0060] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0061] 5) Add the solution and floccu...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com