A method for modifying ubiquitin and inhibiting ubiquitination pathway
A technology of ubiquitination and ubiquitination, which is applied in the fields of life science and microbial protein function and application, and can solve the problem that modification is not the final product.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Expression and Purification of CteC Recombinant Protein
[0027] 1. Construction of expression plasmids
[0028] Using the genomic DNA of Chromobacterium violaceum ATCC 12472 strain as a template, primers F1: GATAGGATCCATGCTATTTTTCACCGGTCTGC (SEQ ID NO.1) and R1: GATACTCGAGTTAGACCGACGCCAACTCCTG (SEQ ID NO.2) were designed according to the gene sequence (CV_1647) on NCBI to obtain CteC by PCR Full-length target fragments.
[0029] The full-length target fragment of CteC was constructed into the kanamycin-resistant prokaryotic expression plasmid pRSF-Duet-His-SUMO vector (the vector in pRSF-Duet1 (Novagen) on the basis of inserting the SUMO protein after the His tag) to obtain pRSF-Duet1-His-SUMO-CteC. The His-tagged protein can be affinity-purified with Ni magnetic beads, and the SUMO protein can be specifically recognized by Ulp1 enzyme for subsequent removal of the tagged protein.
[0030] 2. Protein expression
[0031] Transform pRSF-Duet1-His-SUMO-CteC into Esche...
Embodiment 2
[0034] Example 2: ADP-ribosylation modification of ubiquitin molecules by effector protein CteC
[0035] In a 15μL reaction system (reaction buffer is 20mM HEPES pH 7.4, 150mM NaCl), add 1μM Ub (the protein purification method is the same as the reference Wan et al., 2019, doi:10.1038 / s41564-019-0454-1) and 0.1 μM of the CteC protein purified in Example 1, set the NAD concentration gradients to 0, 0.25, 2.5, 25, 250, 2500 μM, and react at 37°C for 30 minutes, then run 15% SDS-PAGE and 8% Native PAGE respectively , if Ub undergoes a modification reaction, it can migrate upward on 15% SDS-PAGE gel, and migrate downward on 8% Native PAGE. In vitro biochemical experiments showed that the modification of Ub by CteC depends on NAD as a ligand ( figure 2 ), and the modified Ub can be recognized by ADPr antibody (MABE1016, Millipore) ( image 3 ). Through sequence alignment analysis, it was found that CteC was similar to some ARTs, with a conserved "RSE motif" ( Figure 4 ). In ...
Embodiment 3
[0038] Example 3 Effect of ADP-ribosylation modification of ubiquitin molecule by effector protein CteC on ubiquitination pathway and host cells.
[0039] Ubiquitin molecules participate in various signaling pathways after forming different forms of ubiquitin chains through cascade reactions. The use of different E2 and E3 forms specific forms of ubiquitin chains. In this example, UbcH5c and IpaH3 were used to synthesize the K48 chain, and Uev1a, Ubc13 and TRAF6 were used to synthesize the K63 chain. (See Wanet al., 2019, doi:10.1038 / s41564-019-0454-1 for the protein particle information and purification methods involved in this example.) The experimental results show that the CteC-modified Ub can form K48 and K63 chains in vitro. reduce( Figure 9 ).
[0040] NF-κB signaling pathway plays an important role in cellular immune response, and the degradation of IκBα is an indicator to detect whether the pathway is activated. The specific experiment is as follows:
[0041] (1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More