Recombinant MHCC97-L liver cancer cells with high expression of mutant EGFR and construction
A technology for MHCC97-L and liver cancer cells, applied in the direction of tumor/cancer cells, genetically modified cells, cells modified by introducing foreign genetic material, etc., can solve problems affecting the effect of treatment, tumor drug resistance, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] (a) Amplification of EGFR(I645L) full-length gene
[0019] Extract the total RNA of MHCC97-H cells, obtain cDNA after reverse transcription, use this as a template, and obtain the full length of EGFR (I645L) gene through PCR reaction, and the primers are:
[0020] · Upstream primer: GCTCAGAATGCGACCCTCCGGGACG
[0021] Downstream primer: ATTTGCGGCCGCTCATGCTCCAATAAATTCACTGC
[0022] The obtained EGFR (I645L) gene full length is recovered after XbaI and NotI double enzyme digestion (such as figure 2 ).
[0023] The pCDH-EF1-MCS-puro plasmid is recovered after double digestion with XbaI and NotI (such as figure 2 ).
[0024] ·The digested plasmid and the PCR product were ligated and then transformed into DH5α competent. Single clones were picked and sequenced. Obtain pCDH-puro-EGFR(I645L) eukaryotic expression vector (such as image 3 ).
[0025] (b) Virus construction and enrichment
[0026] The pCDH-puro-EGFR (I645L) plasmid virus needs to be obtained in 293T ce...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



