Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant MHCC97-L liver cancer cells with high expression of mutant EGFR and construction

A technology for MHCC97-L and liver cancer cells, applied in the direction of tumor/cancer cells, genetically modified cells, cells modified by introducing foreign genetic material, etc., can solve problems affecting the effect of treatment, tumor drug resistance, etc.

Active Publication Date: 2020-06-09
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

EGFR mutation not only causes tumor resistance to targeted drugs, but also off-targets EGFR-targeted specific drugs, seriously affecting the effect of treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant MHCC97-L liver cancer cells with high expression of mutant EGFR and construction
  • Recombinant MHCC97-L liver cancer cells with high expression of mutant EGFR and construction
  • Recombinant MHCC97-L liver cancer cells with high expression of mutant EGFR and construction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] (a) Amplification of EGFR(I645L) full-length gene

[0019] Extract the total RNA of MHCC97-H cells, obtain cDNA after reverse transcription, use this as a template, and obtain the full length of EGFR (I645L) gene through PCR reaction, and the primers are:

[0020] · Upstream primer: GCTCAGAATGCGACCCTCCGGGACG

[0021] Downstream primer: ATTTGCGGCCGCTCATGCTCCAATAAATTCACTGC

[0022] The obtained EGFR (I645L) gene full length is recovered after XbaI and NotI double enzyme digestion (such as figure 2 ).

[0023] The pCDH-EF1-MCS-puro plasmid is recovered after double digestion with XbaI and NotI (such as figure 2 ).

[0024] ·The digested plasmid and the PCR product were ligated and then transformed into DH5α competent. Single clones were picked and sequenced. Obtain pCDH-puro-EGFR(I645L) eukaryotic expression vector (such as image 3 ).

[0025] (b) Virus construction and enrichment

[0026] The pCDH-puro-EGFR (I645L) plasmid virus needs to be obtained in 293T ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant MHCC97-L liver cancer cells with stable high expression of mutant EGFR and constructed on the basis of exogenous recombinant plasmid pCDH-puro-EGFR(I645L). Specifically, the stable expression MHCC97-L cells are constructed through obtaining of a total length of an EGFR-I645L gene, construction of a pCDH-puro-EGFR(I645L) plasmid, packaging of a virus, puromycin screening of cells infected with the virus, and passage. The establishment of the cells can provide a cell model for screening and drug-resistant study of EGFR pathway related medicines for liver cancer and tumor, and the screening specificity and sensitivity are improved; and the cells can be applied to difference comparison study of related pathway protein under the influence of EGFR.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the construction of a mutant EGFR expression plasmid and the construction of a liver cancer cell with high expression of the mutant EGFR. [0002] technical background [0003] Liver cancer is one of the malignant tumors that seriously threaten human health. It has the characteristics of high malignancy, strong infiltration and metastasis, and congenital drug resistance. It ranks sixth in cancer incidence and third in mortality. At present, the estimated annual number of new cases in the world is about 748,300. my country is the country with the highest incidence of liver cancer and the highest number of deaths in the world, and liver cancer patients account for 55% of the world. Recent studies have shown that EGFR is often highly expressed in liver cancer tissues and adjacent liver tissues of patients with primary liver cancer. Academic behavior and prognosis are more cl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/85C12N15/12C12R1/91
CPCC12N5/0693C07K14/71C12N2510/00
Inventor 刘扬尹雅蕾
Owner DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More