Method for changing cucumber tendril traits
A cucumber and tendril technology, applied in the fields of biotechnology, plant improvement, and molecular biology, can solve the problems of costing a lot of manpower and material resources, destroying tendrils, etc., and achieve the effects of reducing the consumption of manpower and material resources, changing the properties of tendrils, and increasing production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Example 1 Using the CRISPR / Cas9 system to edit the Csa6G160180 gene
[0070] The ACO1 gene in cucumber was edited using CRISPR / Cas9 system, and cucumber mutants with base deletion and base insertion in ACO1 gene were obtained. Specific steps are as follows:
[0071] 1. Design of sgRNA sequence
[0072] The target site sequence was designed on the ACO1 gene with a length of 19bp. The target site is located at positions 411-429 of the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide sequence of the target site is AAGAACACATAGCCAGCAA (shown in SEQ ID NO.2).
[0073] According to the nucleotide sequence of the above target site, the sgRNA sequence was designed as shown in SEQ ID NO.3: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC.
[0074] The DNA molecule encoding the above sgRNA is shown in SEQ ID NO.11: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0075] 2. Construction of CRISPR / Cas9 vecto...
Embodiment 2A
[0086] Identification of transgenic plants with mutations in the ACO1 gene in Example 2
[0087] The tendrils of different T0 transgenic cucumber plants obtained in Step 3 of Example 1 were collected, and genomic DNA was extracted as a template, and PCR amplification was performed on different strains using ACO1 gene primers to obtain PCR amplification products of different strains.
[0088] The PCR amplification products of different strains were subjected to Sanger sequencing, and compared with the wild-type ACO1 gene according to the sequencing results. According to the measured results, the ACO1 gene was analyzed.
[0089] figure 1 and figure 2 The results of the sequencing comparison showed that the CRISPR / Cas9 system was used to successfully edit the cucumber ACO1 gene, resulting in two gene mutation patterns: (1) aco1-1 mutation: the nucleoside shown in SEQ ID NO.1 The 425th (A base) and 426th (G base) of the acid sequence were knocked out; (2) aco1-2 mutation: the ...
Embodiment 3
[0090] The observation of embodiment 3 cucumber plant phenotypes
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


