The Method of Changing the Properties of Cucumber Tendrils

A cucumber and tendril technology, applied in the fields of molecular biology, biotechnology and plant improvement, can solve the problems of destroying tendrils and spending a lot of manpower and material resources, so as to reduce the consumption of manpower and material resources, increase production, and change the properties of tendrils.

Active Publication Date: 2021-12-03
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the field production of cucumbers, in order to achieve high yields, it is often necessary to knock out the tendrils, spending a lot of manpower and material resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The Method of Changing the Properties of Cucumber Tendrils
  • The Method of Changing the Properties of Cucumber Tendrils
  • The Method of Changing the Properties of Cucumber Tendrils

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1 Using the CRISPR / Cas9 system to edit the Csa6G160180 gene

[0070] The ACO1 gene in cucumber was edited using CRISPR / Cas9 system, and cucumber mutants with base deletion and base insertion in ACO1 gene were obtained. Specific steps are as follows:

[0071] 1. Design of sgRNA sequence

[0072] The target site sequence was designed on the ACO1 gene with a length of 19bp. The target site is located at positions 411-429 of the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide sequence of the target site is AAGAACACATAGCCAGCAA (shown in SEQ ID NO.2).

[0073] According to the nucleotide sequence of the above target site, the sgRNA sequence was designed as shown in SEQ ID NO.3: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC.

[0074] The DNA molecule encoding the above sgRNA is shown in SEQ ID NO.11: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0075] 2. Construction of CRISPR / Cas9 vecto...

Embodiment 2A

[0086] Identification of transgenic plants with mutations in the ACO1 gene in Example 2

[0087] The tendrils of different T0 transgenic cucumber plants obtained in Step 3 of Example 1 were collected, and genomic DNA was extracted as a template, and PCR amplification was performed on different strains using ACO1 gene primers to obtain PCR amplification products of different strains.

[0088] The PCR amplification products of different strains were subjected to Sanger sequencing, and compared with the wild-type ACO1 gene according to the sequencing results. According to the measured results, the ACO1 gene was analyzed.

[0089] figure 1 and figure 2 The results of the sequencing comparison showed that the CRISPR / Cas9 system was used to successfully edit the cucumber ACO1 gene, resulting in two gene mutation patterns: (1) aco1-1 mutation: the nucleoside shown in SEQ ID NO.1 The 425th (A base) and 426th (G base) of the acid sequence were knocked out; (2) aco1-2 mutation: the ...

Embodiment 3

[0090] The observation of embodiment 3 cucumber plant phenotypes

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for changing the properties of cucumber tendrils, and relates to the technical fields of molecular biology, biotechnology and plant improvement. The above method is to edit the Csa6G160180 gene in cucumber, so that the gene is not expressed, or the expression activity level is reduced, or the expressed protein ACC oxidase is inactivated or the activity is reduced, so as to achieve the purpose of changing the properties of cucumber tendrils, and cultivate tendril-free cucumbers or tendrils. New improved cucumber varieties that lose climbing ability, reduce the consumption of manpower and material resources in the process of cucumber cultivation, and increase the yield of cucumbers.

Description

technical field [0001] The invention relates to the technical fields of molecular biology, biotechnology and plant improvement, in particular to a method for changing the properties of cucumber tendrils. Background technique [0002] Cucumber is a vine or climbing herbaceous plant of Cucurbitaceae. It is an important vegetable crop in the world and the largest vegetable crop cultivated in protected areas in my country. It is also a model plant for studying sex differentiation, vascular bundle development and plant haptic movement. Tendrils are the unique climbing organs of Cucurbitaceae, which can enable plants to gain the ability to climb to high places and gain more living space. However, under protected cultivation conditions, such as in greenhouses and greenhouses, cucumbers are mainly carefully managed by artificial tying. Since cucumbers do not need tendrils to climb, in order to reduce the waste of biomass, farmers need to manually remove tendrils. [0003] Cucumber...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/53C12N5/10A01H5/04A01H6/34
CPCC12N9/0071C12N15/8218C12N15/8261C12Y114/17004
Inventor 杨学勇黄三文辛同旭王博文闫建斌王深浩张忠华
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap