Leuconostoc lactis and applications thereof

A Leuconostoc and lactic acid technology, applied in the field of microorganisms, can solve problems such as lack of excavation, and achieve the effects of promoting sensory quality, improving aroma quality, and increasing yield

Pending Publication Date: 2020-06-19
四川老坛子食品有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In the process of food fermentation, there are many types of lactic acid bacteria that can produce n-nonanol, but the types of lactic acid bacteria that can achieve the desired yield effect and product aroma through fermentation are still lacking.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leuconostoc lactis and applications thereof
  • Leuconostoc lactis and applications thereof
  • Leuconostoc lactis and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0068] And provide the preparation method of above-mentioned work leavening agent, comprise the following steps:

[0069] S1 provides sterile skim milk;

[0070] The specific steps are: weigh 10-12% (m / v) skimmed milk powder, 2%-4% (m / v) glucose and 1-2% glycerin, add pure water to fully dissolve it, and heat it at 95°C Sterilize for 20 minutes, then cool to 37-40°C to obtain aseptic skim milk.

[0071] S2 activates the Leuconostoc lactis species;

[0072] The specific steps are: use an inoculation loop to take a ring of Leuconostoc lactis CCTCC M2019444 bacterial species preserved in a freeze-dried tube dissolved in sterile water, streak it on the MRS agar medium plate, and cultivate it in a 37°C incubator for 24 to 48 hours to Single colonies grow. Described MRS agar medium is a lactic acid bacteria medium, and is not necessarily limited to MRS agar medium, and all culture mediums capable of cultivating strains can be used.

[0073] S3 prepares the strain culture medium,...

Embodiment 1

[0104] The collection, separation, selection method of embodiment 1 Leuconostoc lactis CCTCC M 2019444

[0105] (1) Obtain a suitable dilution gradient and culture

[0106] Samples were collected from naturally fermented kimchi products in Sichuan, Jiangsu and other places. The collected samples were refrigerated in an ice box, kept at a lower temperature and brought back to the laboratory and stored at -80°C for later use. Weigh 1mL of the sample, add it to 9mL of sterile water, and then take 1mL of the bacterial solution and dilute it in 9mL of sterile water, so that the concentration of the sample is diluted to 10 -4 , taking four dilutions of 10 to 10 4 50 μL of each bacterial suspension was spread on the MRS agar plate, and cultured at a constant temperature of 37 °C for 36-48 h under facultative anaerobic conditions.

[0107] (2) Separation and purification

[0108] Use the plate streaking method to select single colonies with different sizes, raised, slightly white,...

Embodiment 2

[0119] Example 2 Identification of Leuconostoc lactis L7ZSAAS01

[0120] (1) Physiological and biochemical identification

[0121] Strain L7ZSAAS01 is a Gram-positive, peroxidase-negative, non-motile bacillus capable of growth at 15°C and 40°C.

[0122] (2) PCR amplified 16S rDNA sequence analysis of strain L7ZSAAS01

[0123] 1) Aspirate 1mL of shaken and mixed liquid culture medium, centrifuge and discard the supernatant, blow and wash with 1mL sterile water twice, centrifuge and discard the supernatant, and use it as a template for colony PCR. The PCR system is 50 μL, of which Mix is ​​25 μL, 27F is 1 μL, 1492R is 1 μL, and ddH2O is 23 μL.

[0124] The primers used were (16s27F:GAGAGTTTGATCCTGGCTCAG; 16s 1492R:CGGCTACCTTGTTACGACTT). The nucleotide sequence of the amplified fragment is shown as SEQ ID No 3, and the length is 429bp.

[0125] Phylogenetic tree analysis was performed on the sequence obtained by sequencing, and the experimental results are attached figure 1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses leuconostoc lactis and applications thereof. The leuconostoc lactis is deposited with the China Center for Type Culture Collection and assigned an accession number CCTCC M 2019444. The leuconostoc lactis CCTCC M 2019444 has acid and salt resistance, can grow well under the environment that pH is 4.0 and the content of NaCl is 6%, and can highly produce 1-nonanol; the strainhas good growth characteristics in brine and vegetable juice; and the strain has good acid production characteristics in the brine and the vegetable juice, the pH is 5.58 after fermentation is performed for 18 h. Through the detection on the 1-nonanol content in prepared fermented vegetables and fermented vegetable juice beverages and the determination of types of volatile flavor compounds, the 1-nonanol production of the leuconostoc lactis can be increased by 60.49-61.53% through the indication of results, so that the fragrance quality of products can be improved, and the enhancement of thesensory quality of the products can be promoted; and therefore, the leuconostoc lactis has wide application prospects in the field of fermented vegetable products.

Description

technical field [0001] The invention relates to the technical field of microorganisms, in particular to Leuconostoc lactis and its application. Background technique [0002] Fermented food is a kind of food that is processed and manufactured by people using beneficial microorganisms. Fermented food has a unique flavor, such as yogurt, cheese, fermented rice, kimchi, soy sauce, vinegar, tempeh, rice wine, beer, wine, etc. Lactic acid bacteria are a kind of gram-positive bacteria without spore structure that can metabolize carbohydrates into lactic acid. Most of them are beneficial bacteria. Due to their special metabolic characteristics, different species of lactic acid bacteria are often widely used in food processing. , The contribution to my country's fermented food processing industry cannot be underestimated. [0003] And n-nonanol (1-Nonanol, C 9 h 20 O), is one of the important flavor compounds in lactic acid fermented food, which usually endows the food with rich fl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12P7/04A23L29/00A23L19/20A23L2/38C12R1/01
CPCC12N1/20C12P7/04A23L29/065A23L19/20A23L2/382A23V2002/00C12R2001/01C12N1/205A23V2200/15Y02A40/90
Inventor何艳平卢伟赵楠
Owner四川老坛子食品有限公司