Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of reagent for detecting expression level of formyl peptide receptor 1 (FPR1) gene

A gene expression level and reagent technology, applied in the application field of reagents in the diagnosis of bacterial-negative pulmonary tuberculosis, can solve the problems of low early diagnosis rate, low diagnosis of bacterial-negative pulmonary tuberculosis, and difficulties in the diagnosis of bacterial-negative pulmonary tuberculosis, and achieve easy judgment and accurate results Effect

Inactive Publication Date: 2020-06-19
SOUTHERN MEDICAL UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although a variety of new diagnostic techniques based on immunology, molecular biology, and enzymology have emerged, even if multiple diagnostic techniques are combined, the diagnosis of bacterial-negative pulmonary tuberculosis is still low, and the early diagnosis rate is lower. The incidence of tuberculosis and comorbidities of other diseases such as AIDS have been declining in recent years, especially the diagnosis of bacterium-negative pulmonary tuberculosis is still a major difficulty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of reagent for detecting expression level of formyl peptide receptor 1 (FPR1) gene
  • Application of reagent for detecting expression level of formyl peptide receptor 1 (FPR1) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] 1. Primer design

[0029] Design primers for fluorescent quantitative PCR amplification of human FPR1 gene (NCBI Reference Sequence: NM_002029):

[0030] F: CCAAACCAGTGACACAGCTACC (SEQ ID NO. 1);

[0031] R: CAGCCTAACTCAAGGTGAGACG (SEQ ID NO. 2).

[0032] 2. Test operation

[0033] 1) Isolate the peripheral blood of patients with positive tuberculosis and healthy controls, and destroy red blood cells with red blood cell lysate.

[0034] Lymphocyte separation medium was used to separate peripheral blood mononuclear cells (PBMC) from healthy volunteers; density gradient centrifugation was used to separate and purify PBMC, and the specific operations were as follows:

[0035] ① Add an appropriate amount of Ficoll lymphocyte separation medium to a 15mL graduated sterile centrifuge tube;

[0036] ②Take heparin-anticoagulated peripheral venous blood and an equal amount of RPMI 1640 solution to fully mix and dilute, use a Pasteur dropper to draw 2 times the volume of anti-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a reagent for detecting the expression level of formyl peptide receptor 1 (FPR1) gene in diagnosis of negative bacteria pulmonary tuberculosis. According to theapplication, fluorescent quantitative polymerase chain reaction (PCR) amplification primers, F:CCAAACCAGTGACACAGCTACC and R:CAGCCTAACTCAAGGTGAGACG, of a human FPR1 gene are designed. The technical effect of detecting the expression level of the FPR1 gene in real time is achieved by extracting RNA from human peripheral blood leucocytes; the expression level can be used for distinguishing a healthyperson from a patient with the negative bacteria pulmonary tuberculosis; and the sensitivity and the specificity can be both close to or reach 80% or more, and thereby, treatment and isolation measures for the pulmonary tuberculosis are taken in a more targeted manner.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of a reagent for detecting the expression level of FPR1 gene in the diagnosis of bacterial negative pulmonary tuberculosis. Background technique [0002] Tuberculosis (Tuberculosis, TB) is a major infectious disease caused by Mycobacterium tuberculosis infection that seriously endangers human health. Although there are effective anti-tuberculosis drugs, tuberculosis is still the number one killer of infectious diseases due to the high rate of tuberculosis infection and serious problem of drug resistance. About 2 million people die from tuberculosis every year in the world, and the prevention and control situation is very grim. Early diagnosis of active tuberculosis patients is not only the key to improving the treatment effect, but also the key to effective control of tuberculosis transmission. Sputum Mycobacterium tuberculosis microbiological examination has high spe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6851
CPCC12Q1/6883C12Q1/6851C12Q2600/158C12Q2531/113C12Q2563/107C12Q2521/107
Inventor 马骊胡胜锋韩振玉温茜
Owner SOUTHERN MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More