Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Trace liquid quantifying device, sampling and sample adding method and application in nucleic acid testing

A micro-liquid and quantitative device technology, applied in enzymology/microbiology devices, biological material sampling methods, microbial measurement/inspection, etc., can solve the problems of increasing the difficulty of self-testing by non-professionals, and achieve fast and simple quantification Sampling and adding, easy operation, and easy operation of taking and adding templates

Inactive Publication Date: 2020-07-10
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This increases the difficulty of non-professionals in the field or personal self-testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trace liquid quantifying device, sampling and sample adding method and application in nucleic acid testing
  • Trace liquid quantifying device, sampling and sample adding method and application in nucleic acid testing
  • Trace liquid quantifying device, sampling and sample adding method and application in nucleic acid testing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] In order to confirm that the device can reliably pipette a small amount of liquid, we configured a high-concentration aqueous solution containing Gel-red (purchased from Biotium, USA) dye, and selected thin rods 1 of different materials and different diameters for pipetting experiments.

[0038] First, use a standard pipette gun (Eppendorf) to draw 1-5 microliters of Gelred dye solution ranging from adding to 100 microliters of pure aqueous solution, measure the absorbance at 450nm (as shown in Table 1), and establish a standard curve (see figure 2 ).

[0039] Table 1 Adds the relationship between the volume of Gelred dye solution and the absorption value

[0040]

[0041] figure 2 It is the standard curve between the volume of dye absorbed and the absorbance value, y=0.5399*X+0.04319, R2=0.9978.

[0042] Then use different thin sticks 1 to pipette the dye solution, measure the absorption value of the aqueous solution after adding the sample, and combine the stan...

Embodiment 2

[0050] In order to confirm the beneficial effect of using this device, the following uses loop-mediated isothermal amplification (LAMP) to detect novel coronavirus (COVID-19) in throat swabs of suspected patients as a specific example.

[0051] 1. Preparation of micro-liquid quantitative device: select a polypropylene (PP) plastic rod with a diameter of about 2mm and a length of about 120mm, and use a knife to draw a scratch at the sampling end 2 at a distance of 3mm from the end as mark 3. After being sterilized at a high temperature of 120°C for 30 minutes, it is ready for use.

[0052] 2. For the N gene of the new coronavirus COVID-19, a set of LAMP amplification primers was designed and sent to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for synthesis. The sequence is as follows:

[0053] GeneN-F3 TGGCTACTACCGAAGAGCT GeneN-B3 TGCAGCATTGTTAGCAGGAT GeneN-FIP TCTGGCCCAGTTCCTAGGTAGTCCAGACGAATTCGTGGTGG GeneN-BIP AGACGGCATCATATGGGTTGCACGGGTGCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
lengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a trace liquid quantifying device, a sampling and sample adding method and application in nucleic acid testing, the trace liquid quantifying device comprises a thin rod, one end of the thin rod is used as a sampling end, the trace liquid quantifying device adopts a disposable thin rod to dip a sample and add a sample, and the invention relates to the technical field of trace liquid quantitative sampling. According to the trace liquid quantifying device, the sampling and sample adding method and the application in the nucleic acid testing, sampling and sample adding aredesigned on the basis of the principle that liquid is adsorbed on the surface of an object, rapid, simple and convenient quantitative sampling and sample adding are achieved, the problem of quantitative sampling and sample adding of trace liquid is solved, and template taking and adding operation of a nucleic acid testing is quite easy; the sample taking and adding method is particularly suitablefor sample adding of a trace sample template such as a nucleic acid testing, sampling and sample adding are achieved by adsorbing liquid through the surface of an object, the structure is simple, operation is very easy and convenient, and the method is very suitable for non-professionals to use on site.

Description

technical field [0001] The invention relates to the technical field of micro-liquid quantitative sampling, in particular to a micro-liquid quantitative device, a sampling and adding method, and an application in nucleic acid detection. Background technique [0002] In the detection process of various substances, it is often necessary to quantitatively draw liquid and refill liquid. This process is often completed manually or automatically with the help of special equipment. For example, during nucleic acid PCR and isothermal amplification detection, it is often necessary to add 0.1 to 10 ul of sample template to the final detection system. The commonly used special micro-quantitative sampling and loading is a micropipette. Micropipette is a kind of pipette. Pipettes have different specifications. The pipetting capacity ranges from 0.1ul to several milliliters. The sampling volume can be set through the volume setting knob. Different specifications of pipettes Compatible wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12M1/34C12M1/26C12Q1/24
CPCC12Q1/24
Inventor 危宏平尼尔森奥地武
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com