Trace liquid quantifying device, sampling and sample adding method and application in nucleic acid testing
A micro-liquid and quantitative device technology, applied in enzymology/microbiology devices, biological material sampling methods, microbial measurement/inspection, etc., can solve the problems of increasing the difficulty of self-testing by non-professionals, and achieve fast and simple quantification Sampling and adding, easy operation, and easy operation of taking and adding templates
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] In order to confirm that the device can reliably pipette a small amount of liquid, we configured a high-concentration aqueous solution containing Gel-red (purchased from Biotium, USA) dye, and selected thin rods 1 of different materials and different diameters for pipetting experiments.
[0038] First, use a standard pipette gun (Eppendorf) to draw 1-5 microliters of Gelred dye solution ranging from adding to 100 microliters of pure aqueous solution, measure the absorbance at 450nm (as shown in Table 1), and establish a standard curve (see figure 2 ).
[0039] Table 1 Adds the relationship between the volume of Gelred dye solution and the absorption value
[0040]
[0041] figure 2 It is the standard curve between the volume of dye absorbed and the absorbance value, y=0.5399*X+0.04319, R2=0.9978.
[0042] Then use different thin sticks 1 to pipette the dye solution, measure the absorption value of the aqueous solution after adding the sample, and combine the stan...
Embodiment 2
[0050] In order to confirm the beneficial effect of using this device, the following uses loop-mediated isothermal amplification (LAMP) to detect novel coronavirus (COVID-19) in throat swabs of suspected patients as a specific example.
[0051] 1. Preparation of micro-liquid quantitative device: select a polypropylene (PP) plastic rod with a diameter of about 2mm and a length of about 120mm, and use a knife to draw a scratch at the sampling end 2 at a distance of 3mm from the end as mark 3. After being sterilized at a high temperature of 120°C for 30 minutes, it is ready for use.
[0052] 2. For the N gene of the new coronavirus COVID-19, a set of LAMP amplification primers was designed and sent to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for synthesis. The sequence is as follows:
[0053] GeneN-F3 TGGCTACTACCGAAGAGCT GeneN-B3 TGCAGCATTGTTAGCAGGAT GeneN-FIP TCTGGCCCAGTTCCTAGGTAGTCCAGACGAATTCGTGGTGG GeneN-BIP AGACGGCATCATATGGGTTGCACGGGTGCC...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap