COVID-19 rapid diagnosis kit and preparation method thereof

A COVID-19, rapid diagnosis technology, applied in the field of disease detection, can solve the problem of no specific treatment for the disease, and achieve the effect of being conducive to effective control and simple operation

Active Publication Date: 2020-07-10
SICHUAN MACCURA BIOTECH CO LTD
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently there is no specific treatment for the disease caused by the novel coronavirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • COVID-19 rapid diagnosis kit and preparation method thereof
  • COVID-19 rapid diagnosis kit and preparation method thereof
  • COVID-19 rapid diagnosis kit and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] A kind of COVID-19 rapid diagnostic kit, comprises colloidal gold of colloidal gold of colloidal protein of COVID-19 fibril protein, is prepared by following method:

[0032] 1. Expression and purification of COVID-19 spike protein

[0033] 1) Fully synthesize the gene encoding the Gln14-Arg685 region of the S1 protein;

[0034] 2) Cloning the S1 gene between the IL2 secretion signal peptide of the eukaryotic expression vector pMFcIg (ABLINK biotech) and the mouse Fc (mFc, including hinge-CH2-CH3) tag gene to form the S1-mFc fusion gene, the cloning method used The forward primer is: CAGTGTGTTAATCTTACAACC, the reverse primer is: ACGTGCCCGCCGAGGAGAATT;

[0035] 3) Transfer the S1-mFc expression plasmid to the competent cell Rosseta by electroporation, pick the positive single clone, and extract the plasmid after amplification;

[0036] 4) Use 293Fectin (thermofisher) transfection reagent to transfect S1-mFc expression plasmid into 293F cells, continue to culture in ser...

Embodiment 2

[0045] Clinical verification of colloidal gold for COVID-19 spike protein antigen prepared by the method in Example 1.

[0046] Take 8 clinically confirmed cases, 10 suspected samples and 10 negative samples of new coronavirus pneumonia for verification. The verification method is as follows:

[0047] Add COVID-19 spike protein antigen colloidal gold into the 96-well plate, add 100ul of the above-mentioned different types of specimens respectively, incubate at 37 degrees for 1 hour, wash the plate, then add the enzyme-labeled secondary antibody against the Fc segment of human IgG, and develop the color reagent for color development, and the color development results are as follows figure 1, using a microplate reader to measure the OD value, the results are as follows figure 2 , 3 shown.

[0048] Clinically confirmed positive (8 cases), suspected samples (10 cases) and negative samples (10 cases) were analyzed. The serum anti-S protein antibodies of positive patients were a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a COVID-19 rapid diagnosis kit. The COVID-19 rapid diagnosis kit comprises COVID-19 spike protein antigen colloidal gold. The invention also discloses a preparation method of the COVID-19 rapid diagnosis kit. The preparation method comprises the following steps: expressing and purifying COVID-19 spike protein; and preparing the COVID-19 spike protein antigen colloidal gold.The kit is simple to operate, can quickly diagnose whether a patient is infected with COVID-19 or not, and is beneficial to effective control of epidemic situations.

Description

technical field [0001] The invention relates to the field of disease detection, in particular to a COVID-19 rapid diagnostic kit and a preparation method thereof. Background technique [0002] Common signs after a person is infected with a coronavirus include respiratory symptoms, fever, cough, shortness of breath, and dyspnea. In more severe cases, infection can lead to pneumonia, severe acute respiratory syndrome, kidney failure, and even death. At present, there is no specific treatment for the disease caused by the new coronavirus. Therefore, disease prevention and early diagnosis are particularly important for controlling the spread of the novel coronavirus. Contents of the invention [0003] In order to improve the early diagnosis efficiency of novel coronavirus, the present invention discloses a COVID-19 rapid diagnostic kit, which is easy to operate and can quickly diagnose whether a patient is infected with COVID-19, which is beneficial to the effective contro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/532C07K14/165C12N15/50C12N15/85
CPCC07K14/005C12N15/85C12N2770/20022G01N33/532G01N33/56983G01N2333/165
Inventor杨正林龚波蒋黎钟凌串俊兰石毅徐雨干盈盈龙腾镶
OwnerSICHUAN MACCURA BIOTECH CO LTD