Unlock instant, AI-driven research and patent intelligence for your innovation.

Plasmid construction method for self-recombination of linearized vector

A technology of linearized vectors and construction methods, which is applied in the field of plasmid construction, can solve the problems of low plasmid yield of target genes, increased synthesis efficiency and purification difficulty, and long experimental cycle, so as to avoid low efficiency, save synthesis costs, and simplify The effect of the design process

Pending Publication Date: 2020-07-21
SICHUAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cloning scheme of target fragments smaller than 150bp is still subject to issues such as annealing efficiency, endonuclease efficiency, and T4DNA ligase efficiency.
For single-stranded oligonucleotide chains less than 150bp, as the length increases, the synthesis efficiency and purification difficulty increase, especially when it is greater than 100bp, there are also problems with the fidelity under current technical conditions
[0006] In addition, the enzyme digestion method requires the use of restriction enzymes and T4 DNA ligase, which is costly, cumbersome, and the experiment cycle is long
Enzyme digestion also depends on the efficiency of endonuclease and ligase. When either of the two is not efficient, it will lead to low yield of plasmid with the target gene ( figure 1 )

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasmid construction method for self-recombination of linearized vector
  • Plasmid construction method for self-recombination of linearized vector
  • Plasmid construction method for self-recombination of linearized vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0031] Example Construction of pEGFP-N1-HA plasmid

[0032] The purpose of this embodiment is to insert the target fragment HA into the GFP sequence (5' end) of the vector pEGFP-N1 to construct a pEGFP-N1-HA plasmid.

[0033] The target fragment-HA sequence is:

[0034] 5'ATGTACCCATACGACGTCCCAGACTACGCT 3'(SEQ ID NO. 1).

[0035] The design idea of ​​the present invention is as follows figure 2 As shown, the process of the present invention is shown in image 3 .

[0036] (1) Method

[0037] 1. Design and synthesize primers

[0038] Primer Primer 5 software was used to design primers.

[0039] Forward primer sequence:

[0040] 5′ TACGACGTCCCA GACTACGCTaagcttcgaattctgcagtcgac 3'(SEQ ID NO. 2);

[0041] Reverse primer sequence:

[0042] 5′ TGGGACGTCGTA TGGGTACATgagctcgagatctgagtccggtag 3'(SEQ ID NO.3);

[0043] Among them, the uppercase part of the primer sequence belongs to the HA sequence, and the underlined and bold parts are the reverse complementary sequences of the forward and reverse pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a simple and convenient plasmid construction method for self-recombination of a linearized vector in a bacterium. The simple and convenient plasmid construction method comprisesthe following steps: (1) a primer pair with target fragments is synthesized; (2) primers are applied, and an empty plasmid vector is adopted as a template for PCR amplification; (3) a PCR product ispurified and recovered, and the linearized vector with the target fragments is obtained; and (4) conversion is conducted, specifically, the linearized vector is recombined in the bacterium to obtain aplasmid. The primers in step (1) each contain two parts, wherein the first part is a sequence which can be complementary to the plasmid vector and is located at the 3' end of the primer, and the second part is a combined fragment which contains the corresponding target fragment and is located at the 5' end of the primer; and the 'second parts' of the two primers in the primer pair contain reversely complementary sequences of 10-15 bp. The simple and convenient plasmid construction method is simplified in step and less in consumed time, and has good application prospects.

Description

Technical field [0001] The invention relates to the field of molecular biology, in particular to a plasmid construction method. Background technique [0002] Plasmid construction is the most commonly used experimental technique in molecular biology research. Its principle depends on the action of restriction endonuclease, T4 DNA ligase and other modifying enzymes. After appropriate cutting and modification of the target gene and vector DNA, respectively, Connect the two together and then introduce them into the host cell to achieve the correct expression of the target gene in the host cell. [0003] Existing techniques for constructing plasmids usually use double digestion-ligation method, that is, to find the same digestion sites at both ends of the target fragment and vector, and then use restriction enzymes to treat them to produce the same sticky ends . [0004] The technical process first is to amplify a large number of target fragments by PCR method, obtain the target ligatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/00C12N15/66
CPCC12N15/70
Inventor 孙晓东张媛媛杨莹陶成成吴越
Owner SICHUAN UNIV