Plasmid construction method for self-recombination of linearized vector
A technology of linearized vectors and construction methods, which is applied in the field of plasmid construction, can solve the problems of low plasmid yield of target genes, increased synthesis efficiency and purification difficulty, and long experimental cycle, so as to avoid low efficiency, save synthesis costs, and simplify The effect of the design process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0031] Example Construction of pEGFP-N1-HA plasmid
[0032] The purpose of this embodiment is to insert the target fragment HA into the GFP sequence (5' end) of the vector pEGFP-N1 to construct a pEGFP-N1-HA plasmid.
[0033] The target fragment-HA sequence is:
[0034] 5'ATGTACCCATACGACGTCCCAGACTACGCT 3'(SEQ ID NO. 1).
[0035] The design idea of the present invention is as follows figure 2 As shown, the process of the present invention is shown in image 3 .
[0036] (1) Method
[0037] 1. Design and synthesize primers
[0038] Primer Primer 5 software was used to design primers.
[0039] Forward primer sequence:
[0040] 5′ TACGACGTCCCA GACTACGCTaagcttcgaattctgcagtcgac 3'(SEQ ID NO. 2);
[0041] Reverse primer sequence:
[0042] 5′ TGGGACGTCGTA TGGGTACATgagctcgagatctgagtccggtag 3'(SEQ ID NO.3);
[0043] Among them, the uppercase part of the primer sequence belongs to the HA sequence, and the underlined and bold parts are the reverse complementary sequences of the forward and reverse pr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


