Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction and application of microRNA-212-3P sponge based on recombinant adeno-associated virus 8

A phbaav-u6-mcs-cmv-egfp, sponge technology, applied in the field of biomedicine, can solve problems such as no miRNA sponge products, and achieve the effect of reducing liver lipid accumulation, prominent effect, and serum lipid content.

Active Publication Date: 2020-07-31
SHANGHAI TONGJI HOSPITAL
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no miRNA sponge product designed to target miR-212-3P that can effectively treat NAFLD

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of microRNA-212-3P sponge based on recombinant adeno-associated virus 8
  • Construction and application of microRNA-212-3P sponge based on recombinant adeno-associated virus 8
  • Construction and application of microRNA-212-3P sponge based on recombinant adeno-associated virus 8

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Exercise regulates hepatic lipid accumulation in nonalcoholic fatty liver disease through miR-212-3P 1. Method

[0029] Forty male C57 / BL6 mice were randomly divided into normal diet group, normal diet & exercise group, high-fat diet group, high-fat diet & exercise group (10 mice in each group). Normal diet group and high-fat diet group were fed with standard feed and high-fat diet for 16 weeks; normal diet & exercise group and high-fat diet & exercise group were given 60min / d, 10m / min Running exercise, a total of 16 weeks. Four groups of mice were sacrificed after intraperitoneal anesthesia at the end of the 16th week, and blood was collected by picking eyeballs. The complete liver tissue specimens were cut out, weighed, and part of the right lobe of the liver was fixed with 4% neutral formaldehyde for pathological detection; Quick-frozen in liquid nitrogen and stored in a -80°C refrigerator. Serum was stored in a -20°C refrigerator for serological liver fu...

Embodiment 2

[0036] Example 2 rAAV8-miR-212-3P-Sponge can effectively prevent lipid accumulation in non-alcoholic fatty liver disease caused by high-fat diet

[0037] 1. Method

[0038] 1.1 Preparation of adeno-associated virus

[0039] 1.1.1rAAV8-miR-212-3P-Sponge

[0040] miR-212-3p sequence: TAACAGTCTCCAGTCACGGCCA (SEQ ID NO: 1)

[0041] Its reverse complementary sequence: TGGCCGTGACTGGAGACTGTTA (SEQ ID NO: 2)

[0042] Use pHBAAV-U6-MCS-CMV-EGFP as the basic vector, digest, recover the vector, connect the target fragment, transform the competent cell DH5α, sequence and identify, and construct the vector pHBAAV-U6-miR-212-3P-Sponge-CMV -EGFP (sequence shown in SEQ ID NO:3), the target fragment sequence connected into the vector is shown in the 442-569bp of SEQ ID NO:3.

[0043] Then the prepared plasmid pHBAAV-U6-miR-212-3P-Sponge-CMV-EGFP and pAAV-RC (sequence shown in SEQ ID NO: 4) and pHelper (sequence shown in SEQ ID NO: 5), Co-transfect AAV-293 cells, replace with complete medium...

Embodiment 3

[0053] Example 3 Screening of rAAV8-miR-212-3P-Sponge

[0054] In this study, a variety of miR-212-3P sponges were designed, and some results are selected as examples, as follows:

[0055] 1. Method

[0056] 1.1 Preparation of adeno-associated virus

[0057] 1.1.1rAAV8-miR-212-3P-Sponge

[0058] With embodiment 2.

[0059] 1.1.2rAAV8-miR-212-3P-Sponge 对照

[0060] The preparation method is the same as that of rAAV8-miR-212-3P-Sponge, except that the target fragment inserted into the pHBAAV-U6-MCS-CMV-EGFP vector is replaced with SEQ ID NO:7.

[0061] 1.2 Administration and detection

[0062] Eighteen C57 / BL6 mice of 6-8 weeks were randomly divided into 3 groups, high-fat diet + basic vehicle group (Contrl), high-fat diet + rAAV8-miR-212-3P Sponge 对照 group (Sponge Control), high-fat diet+rAAV8-miR-212-3PSponge group (Sponge). Administration and detection according to the method of Example 2.

[0063] 2. Results

[0064] Figure 6 Middle A shows the changes in the live...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction and application of a microRNA-212-3P sponge based on a recombinant adeno-associated virus 8. Reduction of the expression of miR-212-3P of the liver can reduce accumulation of liver lipid, and nonalcoholic fatty liver diseases caused by high fat diets can be prevented. The microRNA-212-3P sponge is constructed, and is delivered based on a rAAV8 carrier. A genetherapy is confirmed to be notable in effects on accumulation of the liver lipid and reduction of content of serum lipid, and favorable experiment NAFLD prevention and treatment effects are achieved.A new tool is provided for gene therapy of the nonalcoholic fatty liver diseases.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to the construction and application of a microRNA-212-3P sponge based on recombinant adeno-associated virus type 8. Background technique [0002] Nonalcoholic fatty liver disease (NAFLD) usually begins with simple steatosis and is characterized by the accumulation of triglycerides (TG) within lipid droplets in hepatocytes, which can progress to nonalcoholic steatohepatitis , liver cirrhosis, and even hepatocellular carcinoma. Effective prevention and treatment of NAFLD is of great significance to improve people's quality of life and disease prognosis. At present, there is no clinically effective drug for the prevention and treatment of NAFLD, and lifestyle intervention is still the preferred prevention and treatment method for NAFLD, including healthy diet and exercise. Clinical studies have shown that exercise can effectively prevent the occurrence and development of NAFLD. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/864C12N15/113C12N7/01A61K31/7088A61P1/16
CPCA61K31/7088A61P1/16C12N7/00C12N15/113C12N15/86C12N2310/141C12N2320/32C12N2750/14121C12N2750/14143
Inventor 杨文卓刘瑞麟孙波
Owner SHANGHAI TONGJI HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products