Construction and application of microRNA-212-3P sponge based on recombinant adeno-associated virus 8
A phbaav-u6-mcs-cmv-egfp, sponge technology, applied in the field of biomedicine, can solve problems such as no miRNA sponge products, and achieve the effect of reducing liver lipid accumulation, prominent effect, and serum lipid content.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Exercise regulates hepatic lipid accumulation in nonalcoholic fatty liver disease through miR-212-3P 1. Method
[0029] Forty male C57 / BL6 mice were randomly divided into normal diet group, normal diet & exercise group, high-fat diet group, high-fat diet & exercise group (10 mice in each group). Normal diet group and high-fat diet group were fed with standard feed and high-fat diet for 16 weeks; normal diet & exercise group and high-fat diet & exercise group were given 60min / d, 10m / min Running exercise, a total of 16 weeks. Four groups of mice were sacrificed after intraperitoneal anesthesia at the end of the 16th week, and blood was collected by picking eyeballs. The complete liver tissue specimens were cut out, weighed, and part of the right lobe of the liver was fixed with 4% neutral formaldehyde for pathological detection; Quick-frozen in liquid nitrogen and stored in a -80°C refrigerator. Serum was stored in a -20°C refrigerator for serological liver fu...
Embodiment 2
[0036] Example 2 rAAV8-miR-212-3P-Sponge can effectively prevent lipid accumulation in non-alcoholic fatty liver disease caused by high-fat diet
[0037] 1. Method
[0038] 1.1 Preparation of adeno-associated virus
[0039] 1.1.1rAAV8-miR-212-3P-Sponge
[0040] miR-212-3p sequence: TAACAGTCTCCAGTCACGGCCA (SEQ ID NO: 1)
[0041] Its reverse complementary sequence: TGGCCGTGACTGGAGACTGTTA (SEQ ID NO: 2)
[0042] Use pHBAAV-U6-MCS-CMV-EGFP as the basic vector, digest, recover the vector, connect the target fragment, transform the competent cell DH5α, sequence and identify, and construct the vector pHBAAV-U6-miR-212-3P-Sponge-CMV -EGFP (sequence shown in SEQ ID NO:3), the target fragment sequence connected into the vector is shown in the 442-569bp of SEQ ID NO:3.
[0043] Then the prepared plasmid pHBAAV-U6-miR-212-3P-Sponge-CMV-EGFP and pAAV-RC (sequence shown in SEQ ID NO: 4) and pHelper (sequence shown in SEQ ID NO: 5), Co-transfect AAV-293 cells, replace with complete medium...
Embodiment 3
[0053] Example 3 Screening of rAAV8-miR-212-3P-Sponge
[0054] In this study, a variety of miR-212-3P sponges were designed, and some results are selected as examples, as follows:
[0055] 1. Method
[0056] 1.1 Preparation of adeno-associated virus
[0057] 1.1.1rAAV8-miR-212-3P-Sponge
[0058] With embodiment 2.
[0059] 1.1.2rAAV8-miR-212-3P-Sponge 对照
[0060] The preparation method is the same as that of rAAV8-miR-212-3P-Sponge, except that the target fragment inserted into the pHBAAV-U6-MCS-CMV-EGFP vector is replaced with SEQ ID NO:7.
[0061] 1.2 Administration and detection
[0062] Eighteen C57 / BL6 mice of 6-8 weeks were randomly divided into 3 groups, high-fat diet + basic vehicle group (Contrl), high-fat diet + rAAV8-miR-212-3P Sponge 对照 group (Sponge Control), high-fat diet+rAAV8-miR-212-3PSponge group (Sponge). Administration and detection according to the method of Example 2.
[0063] 2. Results
[0064] Figure 6 Middle A shows the changes in the live...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap