Dual-signal amplification AuNPs-DNA walker based on hairpin structure transformation and preparation method
A card-issuing structure and dual-signal technology, which is applied in biochemical equipment and methods, and microbial measurement/inspection, etc., can solve problems such as complex detection systems, and achieve simple detection systems, easy operation, and improved sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] A method for preparing a dual-signal amplification AuNPs-DNA walker for detecting target mRNA (TK1) at different concentrations, comprising the following steps:
[0046] (1) Preparation of gold nanoparticles (AuNPs)
[0047] (2) Preparation of DNA-functionalized gold nanoparticles (AuNPs-DNA walkers)
[0048] (3) Different concentrations of target mRNA (TK1) reacted with AuNPs-DNA walker.
[0049] (4) Fluorescence detection.
[0050] The specific method of step (1) is: first, soak all the glass instruments used in the laboratory in aqua regia (freshly prepared, V HCl :V HNO3 =3:1) for 12 hours, then rinse the glassware with a large amount of ultrapure water, and place it in an oven to dry. Then, add 50 mL of 0.25 mM chloroauric acid into a cleaned and dried round bottom flask, and heat to boil in an oil bath at 150°C for 15 min under high-speed stirring. Next, 1 mL of freshly prepared trisodium citrate with a mass fraction of 1% was quickly added to the boiling chl...
Embodiment 2
[0056] A method for preparing a dual signal amplification AuNPs-DNA walker for detecting target mRNA (TK1), comprising the following steps:
[0057] (1) Preparation of gold nanoparticles (AuNPs)
[0058] (2) Preparation of DNA-functionalized gold nanoparticles (AuNPs-DNA walkers)
[0059] (3) Different target mRNA (TK1) reacted with AuNPs-DNA walker.
[0060] (4) Fluorescence detection.
[0061] Steps (1), (2), and (4) are the same as in Example 1.
[0062] The main steps of the reaction process in step (3) are as follows: respectively add 10 nM target mRNA (TK1), three interference targets (c-myc, survivin and c-raf-1) and a blank sample into a mixture containing 1 nM of AuNPs-DNA walker and 0.5 μM of Cu 2+ Placed in 0.01% Tween-20 1×PBS, reacted for 80 min. Interference target c-myc sequence: 5'-CCTCAACGTTAGCTTCACCAA-3'. Interference target survivin sequence: 5'-CAAGGAGCTGGAAGGCTGGG-3'. Interference target c-raf-1 sequence: 5'- AATGCATGTCACAGGCGGGA -3'
[0063] Read ...
Embodiment 3
[0065] A preparation method for dual signal amplification AuNPs-DNA walker for intracellular target mRNA (TK1) imaging, comprising the following steps:
[0066] (1) Preparation of gold nanoparticles (AuNPs)
[0067] (2) Preparation of DNA-functionalized gold nanoparticles (AuNPs-DNA walkers)
[0068] (3) Cells were co-incubated with AuNPs-DNA walkers.
[0069] (4) Confocal imaging.
[0070] Steps (1), (2) are the same as in Example 1.
[0071] The main steps of the reaction process of the step (3) are as follows: MCF-7 cells and MCF-10A cells were respectively inoculated on fluorescent plates, so that the number of cells in each fluorescent plate was about 4×10 4 , cultured with 1640 culture medium (containing 1640 medium, 10% FBS, 100 U / mL streptomycin and 100 U / mL penicillin), and then placed the fluorescent plate in a place containing 5% CO 2 and incubated in a 37°C incubator with 95% air. After 24 hours. Discard the old medium and inoculate the cells with 5 μM Cu 2+...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com