Dual-signal amplification AuNPs-DNA walker based on hairpin structure transformation and preparation method

A card-issuing structure and dual-signal technology, which is applied in biochemical equipment and methods, and microbial measurement/inspection, etc., can solve problems such as complex detection systems, and achieve simple detection systems, easy operation, and improved sensitivity

Active Publication Date: 2020-10-23
FUZHOU UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these nanomachines only amplify the signal of the target once, which can only improve the sensitivity to a limited extent.
And it often needs to add different enzymes or auxiliary probes to achieve signal amplification, and the detection system is often more complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dual-signal amplification AuNPs-DNA walker based on hairpin structure transformation and preparation method
  • Dual-signal amplification AuNPs-DNA walker based on hairpin structure transformation and preparation method
  • Dual-signal amplification AuNPs-DNA walker based on hairpin structure transformation and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] A method for preparing a dual-signal amplification AuNPs-DNA walker for detecting target mRNA (TK1) at different concentrations, comprising the following steps:

[0046] (1) Preparation of gold nanoparticles (AuNPs)

[0047] (2) Preparation of DNA-functionalized gold nanoparticles (AuNPs-DNA walkers)

[0048] (3) Different concentrations of target mRNA (TK1) reacted with AuNPs-DNA walker.

[0049] (4) Fluorescence detection.

[0050] The specific method of step (1) is: first, soak all the glass instruments used in the laboratory in aqua regia (freshly prepared, V HCl :V HNO3 =3:1) for 12 hours, then rinse the glassware with a large amount of ultrapure water, and place it in an oven to dry. Then, add 50 mL of 0.25 mM chloroauric acid into a cleaned and dried round bottom flask, and heat to boil in an oil bath at 150°C for 15 min under high-speed stirring. Next, 1 mL of freshly prepared trisodium citrate with a mass fraction of 1% was quickly added to the boiling chl...

Embodiment 2

[0056] A method for preparing a dual signal amplification AuNPs-DNA walker for detecting target mRNA (TK1), comprising the following steps:

[0057] (1) Preparation of gold nanoparticles (AuNPs)

[0058] (2) Preparation of DNA-functionalized gold nanoparticles (AuNPs-DNA walkers)

[0059] (3) Different target mRNA (TK1) reacted with AuNPs-DNA walker.

[0060] (4) Fluorescence detection.

[0061] Steps (1), (2), and (4) are the same as in Example 1.

[0062] The main steps of the reaction process in step (3) are as follows: respectively add 10 nM target mRNA (TK1), three interference targets (c-myc, survivin and c-raf-1) and a blank sample into a mixture containing 1 nM of AuNPs-DNA walker and 0.5 μM of Cu 2+ Placed in 0.01% Tween-20 1×PBS, reacted for 80 min. Interference target c-myc sequence: 5'-CCTCAACGTTAGCTTCACCAA-3'. Interference target survivin sequence: 5'-CAAGGAGCTGGAAGGCTGGG-3'. Interference target c-raf-1 sequence: 5'- AATGCATGTCACAGGCGGGA -3'

[0063] Read ...

Embodiment 3

[0065] A preparation method for dual signal amplification AuNPs-DNA walker for intracellular target mRNA (TK1) imaging, comprising the following steps:

[0066] (1) Preparation of gold nanoparticles (AuNPs)

[0067] (2) Preparation of DNA-functionalized gold nanoparticles (AuNPs-DNA walkers)

[0068] (3) Cells were co-incubated with AuNPs-DNA walkers.

[0069] (4) Confocal imaging.

[0070] Steps (1), (2) are the same as in Example 1.

[0071] The main steps of the reaction process of the step (3) are as follows: MCF-7 cells and MCF-10A cells were respectively inoculated on fluorescent plates, so that the number of cells in each fluorescent plate was about 4×10 4 , cultured with 1640 culture medium (containing 1640 medium, 10% FBS, 100 U / mL streptomycin and 100 U / mL penicillin), and then placed the fluorescent plate in a place containing 5% CO 2 and incubated in a 37°C incubator with 95% air. After 24 hours. Discard the old medium and inoculate the cells with 5 μM Cu 2+...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a dual-signal amplification AuNPs-DNA walker based on hairpin structure transformation and a preparation method. Through the transformation of the hairpin structure, the AuNPs-DNA walker is initiated to progressively move and walk, and the primary amplification of the signal is realized; and the replaced DNA strand can replace the target again to participate in the next cycle, thereby further amplifying the signal. Through the detection strategy, dual amplification of the target signal can be realized. Through the detection strategy, dual amplification of the target signal can be realized, and the detection sensitivity is greatly improved; and amplification strategies of the system are all based on conversion of the hairpin structure, and a detection system of the sensor is simple and easy to operate.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a dual signal amplification AuNPs-DNA walker based on hairpin structure transformation and a preparation method. Background technique [0002] In recent years, methods based on metal nanoparticles, especially gold nanoparticles (AuNPs) have been widely used to construct DNA-functionalized biosensors. There are various ways to construct DNA-functionalized AuNPs biosensors. In order to improve the sensitivity, three-dimensional DNA track and AuNPs-DNA walker (DNA Walker) can be constructed on the surface of AuNPs. Driven by the target or external conditions, the AuNPs-DNA walker can realize signal amplification and target detection. The driving forces driving this three-dimensional orbital motion mainly include metal ions that assist DNAzymes to cut substrates, nucleic acid hybridization, ATP, and photoactivation. These DNA Walker nanomachines adopt different driving meth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6806C12Q1/682C12Q1/6825
CPCC12Q1/6806C12Q1/682C12Q1/6825C12Q2525/301C12Q2563/155C12Q2537/1373C12Q2563/107C12Q2565/607
Inventor陈宪许珂
OwnerFUZHOU UNIV