Unlock instant, AI-driven research and patent intelligence for your innovation.

gRNA sequence of targeted KrasG12D mutant transcript, vector and application of vector

A transcript and sequence technology, applied in the field of medical biology, can solve problems such as poor treatment effect, and achieve the effect of significant technological progress, high safety, and improved targeting and specificity

Pending Publication Date: 2020-11-03
蒋望
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The object of the present invention is to provide a Kras-targeted G12D The construction method and application of the gRNA sequence of the mutant transcript, the adeno-associated virus vector carrying the CasRx system, and the Kras-targeted G12D The gRNA sequence of the mutant transcript, the construction method and application of the adeno-associated virus vector carrying the CasRx system need to solve the problem that the drugs in the prior art are for Kras G12D Technical issues with poor efficacy of targeted therapies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • gRNA sequence of targeted KrasG12D mutant transcript, vector and application of vector
  • gRNA sequence of targeted KrasG12D mutant transcript, vector and application of vector
  • gRNA sequence of targeted KrasG12D mutant transcript, vector and application of vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Targeting Kras G12D Design of the spacer sequence of the gRNA of the transcript

[0020] Targeting Kras G12D A series of spacer sequences of the gRNA of the transcript are designed according to the following conditions:

[0021] 1) The length of the Spacer sequence is 22bp;

[0022] 2) Its 22bp sequence is complementary to the Kras mRNA sequence; (Kras mRNA see NCBI ReferenceSequence: NM_004985.5)

[0023] 3) The Spacer sequence must cover the single nucleotide mutation site A>G of Kras' G12D;

[0024] 4) One base and / or the last base at the 3' end of the Spacer is c.

[0025] According to the above four conditions, the designed spacer sequence is as follows:

[0026] 1) cctacgccatcagctccaacta; as shown in SEQ ID NO.1.

[0027] 2) ccatcagctccaactaccacaa; as shown in SEQ ID NO.2.

[0028] 3) cgccatcagctccaactaccac; as shown in SEQ ID NO.3.

[0029] 4) cttgcctacgccatcagctcca; as shown in SEQ ID NO.4.

[0030] 5) ctcttgcctacgccatcagctc; as shown in SEQ I...

Embodiment 2

[0032] Embodiment 2 contains targeting Kras G12D Construction and Characterization of Transcript-gRNA Adenoviruses

[0033] Such as figure 1 As shown, containing AmpR promoter, AmpR, ori, AAV2 ITR, EF-1α core promoter, SV40-NLS, RfxCas13d, SV40-NLS, HA, hU6 promoter, gRNA-DR, gRNA(DR+spacer), hGHpolyAsignal, AAV2 ITR, The adeno-associated virus vector backbone of f1 ori pAAV-EF1a-Cas13d-HA-U6-sgRNA, this adeno-associated virus vector backbone can carry different therapeutic gRNAs and is widely used in the field of gene therapy.

[0034] The successfully constructed vector is: pAAV-EF1a-Cas13d-HA-U6-sgRNA.

[0035]Wherein, the above spacer sequence: (1.cctacgccatcagctccaacta; 2.ccatcagctccaactaccaa; 3.cgccatcagctccaactaccac; 4.Cttgcctacgccatcagctcca; 5.ctcttgcctacgccatcagctc; 6.cactcttgcctacgccatcagc) is inserted through the site of BbsI.

[0036] BbsI (NEB) digestion AAV2 adeno-associated virus vector backbone vector: BbsI 1ul, 10×NEB buffer 2ul, backbone vector 1ug, water ...

Embodiment 3

[0040] Example 3 Construction of AAV8 carrying CasRx-gRNA (titer about 1*10^13GC / ml).

[0041] The pAAV-EF1a-Cas13d-HA-U6-sgRNA plasmid was packaged with adeno-associated virus (AAV), and its titer was detected.

[0042] The specific method is as follows:

[0043] By using three AAV plasmids (pAAV8-rep / cap-Y-F mutant, pAAV-EF1a-Cas13d-HA-U6-sgRNA / pAAV2-GFP and pHelper ( pAAV2-GFP , pAAV8-rep / cap-Y-F mutant, pHelper three plasmids are commercially available products) transiently transfected 293T cells, resulting in recombinant AAV (rAAV) vector. 293T cells were transiently transfected with polyethyleneimine at 80% confluency. Cells were harvested 72 hours after transfection, lysed, and treated with 25 units / mL of benzoate nuclease. Subsequently, recombinant AAV was purified by iodixanol-based gradient density centrifugation followed by column chromatography. Recombinant AAV vectors were then concentrated to a final volume of 0.5 ml in phosphate buffered saline using Amicon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gRNA sequence of a targeted KrasG12D mutant transcript. A gene sequence consists of gRNA-DR and a spacer sequence, wherein the gene sequence of the gRNA-DR is shown as SEQ ID NO.7, and the spacer sequence is shown as any one of SEQ ID NO.1-6. The invention further discloses an adenovirus vector which carries the gRNA sequence of a targeted KrasG12D mutant transcript. Theinvention further provides the adenovirus vector which carries the gRNA sequence of the targeted KrasG12D mutant transcript and a gene sequence for coding a CasRx protein. The invention further provides an application of the adenovirus vector to preparation of a medicine for treating cancer, by using KrasG12D as a target. Compared with targeting property and specificity of conventional shRNA, thetargeting property and the specificity of siRNA are both improved. Compared with a CRISPR-Cas9 technology, the vector has a lower off-target effect.

Description

technical field [0001] The invention belongs to the field of medical biology and relates to a carrier, specifically a Kras-targeting G12D The gRNA sequence of the mutant transcript, the construction method and application of the adeno-associated virus vector carrying the CasRx system. Background technique [0002] Genetic alterations (such as mutations, amplifications, rearrangements, etc.) often result in the activation of oncogenes, which drive cancer development. Among oncogenes, mutations in KRAS, probably the most prevalent in human cancers, encode a small GTPase called Kras. Kras mutations occur in about 90 percent of pancreatic cancers, 30 to 40 percent of colon cancers, 15 to 20 percent of lung cancers, and other cancer types. Kras mutations aberrantly activate downstream signaling pathways that contribute to the promotion and maintenance of cancer malignancy. Unlike other successful anti-tumor targeted inhibitors, despite decades of efforts, the development of dr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/864C12N15/09A61K31/7105A61K48/00A61P35/00
CPCC12N15/113C12N15/86C12N15/09A61K31/7105A61P35/00C12N2310/10C12N2750/14143
Inventor 蒋望
Owner 蒋望