Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Diaphorina citri chitin binding protein Chitinase-like EN03 as well as encoding gene and application thereof

A citrus psyllid and protein-binding technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc.

Pending Publication Date: 2020-11-13
GANNAN NORMAL UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are no relevant reports on the structure and function of key genes of citrus psyllid itself

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diaphorina citri chitin binding protein Chitinase-like EN03 as well as encoding gene and application thereof
  • Diaphorina citri chitin binding protein Chitinase-like EN03 as well as encoding gene and application thereof
  • Diaphorina citri chitin binding protein Chitinase-like EN03 as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Screening of Chitin-binding Protein of Citrus Psylla figure 1 ),Specific steps are as follows:

[0029] 1. Extraction of total protein from the epidermis of citrus psyllids

[0030] (1) Take citrus psyllid adult epidermis in a 2mL centrifuge tube, and wash twice with PBS (in the process of taking citrus psyllid epidermis, the taken epidermis should be placed on ice immediately);

[0031] (2) Quickly put the sample obtained in step (1) into an ultra-low temperature refrigerator (-80℃) for freezing;

[0032] (3) Take out the sample of step (2) from the low-temperature refrigerator and grind it into powder with liquid nitrogen;

[0033] (4) Add pre-cooled PBS at a ratio of 0.5g / mL;

[0034] (5) Mix thoroughly, then centrifuge at 12000 rpm at 4°C for 10 min, take the supernatant, and obtain PBS-1;

[0035] (6) Repeat steps (4) and (5) twice to obtain PBS-2 and PBS-3 respectively;

[0036] (7) Recover the precipitate in step (6), add 2% SDS extraction buffer at a ratio of 0.5 g...

Embodiment 2

[0058] Example 2 In vitro chitin binding experiment of prokaryotic expression protein

[0059] The prokaryotic expression of Chitinase-like EN03 coding gene was entrusted to Hangzhou Huaan Biological Company. The purified protein obtained was subjected to the chitin in vitro binding experiment. The experimental method refers to step 3 in Example 1, and only the final concentration of NaCl in the binding buffer is increased. To 500mM. See results Figure 5 , Where M: protein marker, FT: effluent, W1-3: washing liquid first, second, and third time, E: eluent. by Figure 5 It can be seen that the Chitinase-like EN03 protein expressed in prokaryotic cells can bind chitin in vitro and has chitin-binding activity. It can also be combined with cellulose as a control.

Embodiment 3

[0060] Example 3dsRNA synthesis and RNA interference analysis

[0061] 1. Synthesis of dsRNA

[0062] According to the Chitinase-like EN03 protein sequence, find the corresponding gene sequence in the NCBI database (> XM_026833073.1PREDICTED: Diaphorina citri chitinase-like proteinEN03 (LOC103523836), mRNA, the nucleotide sequence shown in SEQ ID NO.4: tcgaatcaacgcttggctccgggtttattcaaattgagttctgattgcaagatgcgagctctaagtgttcttttgttcgtcgcttttgcgatatactactgtgaaggcgtggccaaaacggtgtgctactacaaccataaggcattcaagagagatggaacggccaaagttggacccgaggagctgaagccagccctgagcatgtgcacccatttggtgtacgggttcgctgggatttcggacagcggcgactaccacatcaagtccctggacaaggaattggacacggacaagaacaaaggcaaagagctgttcaaacagataaccgcgctgaaaactttccaacccaacctgaacattatgcttagtgtgggaggatttgaagatgatgatgacaaggagaagtatttggaagtgctggatgacccgaaatacagaaagagtttcatcgaaacaactgtggcagctctgaaaaagtacggcttcaacggattggatctggcctgggaattccccgttgtgactgaaaagcacgaatcttacactcttggatccatctggcataaaatcaagaaaaccgtcaccggacccaaggatgacaatccaacccttcatcgtgaacatttcactctgctcatccgag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a chitin binding protein Chitinase-like EN03 of diaphorina citri, and belongs to the technical field of pest control. The amino acid sequence of the chitin binding protein Chitinase-like EN03 of diaphorina citri is as shown in SEQ ID NO.1. The invention further discloses a preparation method of the chitin binding protein Chitinase-like EN03 of diaphorina citri. The coding gene of the chitin binding protein Chitinase-like EN03 of diaphorina citri is silenced through RNA interference, so that the diaphorina citri can die due to incomplete ecdysis or unsuccessful ecdysis, and the effect of preventing and treating diaphorina citri is achieved.

Description

Technical field [0001] The invention relates to the technical field of disease and insect pest control, in particular to the chitinase-like EN03 of citrus psyllid and its coding gene and application. Background technique [0002] Citri psyllid (Diaphorina citri) belongs to the Hemiptera Psylidae family. It is the main pest in the young shoot stage of citrus. It is also the only vector carrier for the natural transmission of citrus yellow dragon disease discovered in the current research. Citrus Huanglongbing (HLB) is the most devastating disease in the citrus industry in the world, causing huge economic losses to the citrus industry. Strict control of citrus psyllids is a key measure for the prevention and control of citrus yellow dragon disease. The current prevention and control of citrus psyllids are mainly based on chemical control and biological control, that is, chemical insecticides or natural enemy insects and entomopathogenic fungi are used to kill citrus psyllids. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56A01N63/60A01P7/04
CPCC12N9/2442C12Y302/01014A01N63/60
Inventor 余海中卢占军谢妍馨李宁艳喻修道黄爱军易龙苏华楠钟八莲
Owner GANNAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com