Medicine or composition for resisting colorectal cancer

A composition and drug technology, applied in the field of biomedicine, can solve problems such as incomplete effectiveness

Active Publication Date: 2020-12-01
谢琦
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The drugs used to treat colorectal cancer on the market mainly include: Commonly used western medicines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicine or composition for resisting colorectal cancer
  • Medicine or composition for resisting colorectal cancer
  • Medicine or composition for resisting colorectal cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0051] As a preferred embodiment, the promoter of the specific sequence small RNA (CUUUGUCUACAAUUUUGGAAA) is a carrier containing a specific sequence small RNA (CUUUGUCUACAAUUUUGGAAA) nucleic acid fragment. As a more preferred embodiment, the vector containing the nucleic acid fragment of small RNA with specific sequence (CUUUGUCUACAAUUUUGGAAA) is a plasmid containing the nucleic acid fragment of small RNA with specific sequence (CUUUGUCUACAAUUUUGGAAA). As an alternative embodiment, the specific sequence small molecule RNA (CUUUGUCUACAAUUUUGGAAA) is derived from human, mouse, monkey, rabbit or chemically or biologically synthesized.

[0052] In another aspect, the present invention provides an anti-colorectal cancer pharmaceutical composition, comprising a specific sequence small molecule RNA (CUUUGUCUACAAUUUUGGAAA) or its precursor or its mimic or its promoter, and the pharmaceutical composition also contains a chemotherapeutic agent. As an optional embodiment, the pharmaceut...

Embodiment 1

[0063] Example 1 Cell Culture and Transfection

[0064] 1. Cell culture

[0065] Human colorectal cancer cell line HCT116 was used in RPMI-1640 medium containing 10% fetal bovine serum in 5% CO 2 Cultivate in a 37°C incubator, change the medium for 2-3 days, and digest and passage with trypsin containing 0.25% EDTA after reaching more than 90% cell confluence.

[0066] 2. Small RNA compound transfection

[0067] Will 4×10 4 -5×10 4 Each cell was seeded on a 6-well cell culture plate, and 0.5 mL of RPMI1640 cell culture medium containing 10% FBS without antibiotics was added to each well for 12-24 h. Transfection was performed according to the instructions of the transfection reagent lipofectamine 3000 (Invitrogen, USA).

[0068]The experiment was divided into three groups: control group (microRNA-NC, sequence: 5'-UUCUCCGAACGUGUCACGUTT-3') and experimental group (Special sRNA, ath-miR158a-5p, sequence: 5'-CUUUGUCUACAAUUUUGGAAA-3') , while transfecting separately.

Embodiment 2

[0069] Example 2 Detection of cell proliferation activity by CCK-8

[0070] The effect of Special sRNA on the proliferation of HCT116 cells was detected by CCK-8 method. details as follows:

[0071] 1. Cell culture

[0072] HCT116 cells were divided into 1 × 10 3 Each well was inoculated into a 96-well plate in RPMI-1640 medium containing 10% fetal bovine serum in 5% CO 2 cultured in a 37°C incubator.

[0073] 2. The cell transfection steps are the same as in Example 1.

[0074] 3. CCK-8 detection

[0075] According to the complete medium containing 10 μL CCK-8 in 100 μL medium, the old culture medium was removed, and 100 μL cell culture medium containing CCK-8 was added to each well, and culture was continued for 2 h in a 37°C cell culture incubator.

[0076] The absorbance of each well was measured at a wavelength of 462nm by a microplate reader, and the cell growth curve was drawn according to the measured OD values, and the average value was taken, and the proliferat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a medicine or a composition for resisting colorectal cancer. It is first discovered by the invention that in the colorectal cancer generation and development process, overexpression of specific sequence small molecule RNA (such as ath-miR158a or variants thereof) can obviously inhibit proliferation of colorectal cancer cells and promote apoptosis of the colorectal cancer cells, so that an efficient anti-tumor effect is achieved, and the application has important significance in treatment of colorectal cancer tumors.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a drug or composition for anti-colorectal cancer. Background technique [0002] Colorectal cancer (CRC) is a malignant tumor of the digestive system that is commonly seen in the world with a high incidence. second. In addition, with the aging of the population, environmental pollution and changes in eating habits, the incidence of colorectal cancer is increasing year by year. The main cause of colorectal cancer morbidity and death is cancer cell metastasis, but the mechanism of CRC metastasis is still unclear, which makes the prevention and treatment of colorectal cancer more difficult. There are currently four standardized treatments for colorectal cancer: surgery, radiation therapy, chemotherapy, and targeted drug therapy. The drugs used to treat colorectal cancer on the market mainly include: commonly used western medicines include capecitabine, fluorouracil, and irin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K31/7105A61K48/00A61P35/00
CPCA61K31/7105A61P35/00
Inventor 谢琦王玳玮
Owner 谢琦
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products