Drug or composition against colorectal cancer
A composition and drug technology, applied in the field of biomedicine, can solve problems such as incomplete effectiveness, and achieve the effect of high-efficiency anti-tumor effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0051] As a preferred embodiment, the promoter of the specific sequence small RNA (CUUUGUCUACAAUUUUGGAAA) is a carrier containing a specific sequence small RNA (CUUUGUCUACAAUUUUGGAAA) nucleic acid fragment. As a more preferred embodiment, the vector containing the nucleic acid fragment of small RNA with specific sequence (CUUUGUCUACAAUUUUGGAAA) is a plasmid containing the nucleic acid fragment of small RNA with specific sequence (CUUUGUCUACAAUUUUGGAAA). As an alternative embodiment, the specific sequence small molecule RNA (CUUUGUCUACAAUUUUGGAAA) is derived from human, mouse, monkey, rabbit or chemically or biologically synthesized.
[0052] In another aspect, the present invention provides an anti-colorectal cancer pharmaceutical composition, comprising a specific sequence small molecule RNA (CUUUGUCUACAAUUUUGGAAA) or its precursor or its mimic or its promoter, and the pharmaceutical composition also contains a chemotherapeutic agent. As an optional embodiment, the pharmaceut...
Embodiment 1
[0063] Example 1 Cell Culture and Transfection
[0064] 1. Cell culture
[0065] Human colorectal cancer cell line HCT116 was used in RPMI-1640 medium containing 10% fetal bovine serum in 5% CO 2 Cultivate in a 37°C incubator, change the medium for 2-3 days, and digest and passage with trypsin containing 0.25% EDTA after reaching more than 90% cell confluence.
[0066] 2. Small RNA compound transfection
[0067] Will 4×10 4 -5×10 4 Each cell was seeded on a 6-well cell culture plate, and 0.5 mL of RPMI1640 cell culture medium containing 10% FBS without antibiotics was added to each well for 12-24 h. Transfection was performed according to the instructions of the transfection reagent lipofectamine 3000 (Invitrogen, USA).
[0068]The experiment was divided into three groups: control group (microRNA-NC, sequence: 5'-UUCUCCGAACGUGUCACGUTT-3') and experimental group (Special sRNA, ath-miR158a-5p, sequence: 5'-CUUUGUCUACAAUUUUGGAAA-3') , while transfecting separately.
Embodiment 2
[0069] Example 2 Detection of cell proliferation activity by CCK-8
[0070] The effect of Special sRNA on the proliferation of HCT116 cells was detected by CCK-8 method. details as follows:
[0071] 1. Cell culture
[0072] HCT116 cells were divided into 1 × 10 3 Each well was inoculated into a 96-well plate in RPMI-1640 medium containing 10% fetal bovine serum in 5% CO 2 cultured in a 37°C incubator.
[0073] 2. The cell transfection steps are the same as in Example 1.
[0074] 3. CCK-8 detection
[0075] According to the complete medium containing 10 μL CCK-8 in 100 μL medium, the old culture medium was removed, and 100 μL cell culture medium containing CCK-8 was added to each well, and culture was continued for 2 h in a 37°C cell culture incubator.
[0076] The absorbance of each well was measured at a wavelength of 462nm by a microplate reader, and the cell growth curve was drawn according to the measured OD values, and the average value was taken, and the proliferat...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com