Primer group, kit and method for simultaneously detecting mycobacterium tuberculosis composite flora and rpoB gene mutation by LAMP
A technology of complex flora and Mycobacterium tuberculosis, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of unfavorable results, cumbersome separate detection operations, etc., to achieve simple operation, avoid false negatives, adapt to good sex effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The primer set and the reaction system contained in the kit for simultaneous detection of Mycobacterium tuberculosis complex flora and rpoB gene mutation by LAMP in this embodiment are as follows:
[0036] Detection of Mycobacterium tuberculosis complex
[0037] The nucleic acid detection of Mycobacterium tuberculosis complex uses the conserved IS6110 gene fragment, and the sequence of the IS6110 gene fragment is shown in SEQ ID NO:1.
[0038] The primers used for isothermal amplification of the nucleic acid of the Mycobacterium tuberculosis complex IS6110 gene are shown in Table 1.
[0039] Table 1 Primers for specific isothermal amplification of Mycobacterium tuberculosis complex
[0040] Primer name Primer sequence F3 cgccgccaactacggt B3 cggcgctggacgagat LF tcacggttcagggttagcc LB caaagcccgcaggacca FIP gcatctggccacctcgatgctacggtgcccgcaaagt BIP acggctgatgaccaaactcggcggctgtggccggatca
[0041] Table 2 shows the re...
Embodiment 2
[0109] The method for simultaneously detecting the Mycobacterium tuberculosis complex flora and the rpoB gene mutation by the LAMP of the present embodiment comprises the following steps:
[0110] 1) Extract the DNA of the purified sample by conventional methods.
[0111] 2) Preparation of the reaction system for the specific constant temperature amplification of the Mycobacterium tuberculosis compound flora, the constant temperature amplification reaction system of the 516 codon wild type of the Mycobacterium tuberculosis rpoB gene, and the constant temperature amplification reaction system of the 526 codon wild type of the Mycobacterium tuberculosis rpoB gene , Mycobacterium tuberculosis rpoB gene codon 531 wild-type constant temperature amplification reaction system, internal reference gene nucleic acid constant temperature amplification reaction system, loop-mediated isothermal amplification reaction, the reaction is carried out in an integrated device, and five sets of amp...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



