Quantitative detection method, internal standard and kit for nucleic acid of androgen receptor splicing variant-7
A quantitative detection and internal standard technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of cumbersome operation process, cumbersome operation, long time, etc., and achieve simplified operation process, repeated Good performance and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Example 1 AR-V7 QS primer pair and probe screening
[0067] 1.1 AR-V7 sequence is:
[0068] TTGTCCATCTTGTCGTCTTCGGAAATGT TATGAAGCAGGGATGA CTCTGGGAGAAAAATTCCGGGTTGGCAATTG.
[0069] The AR-V7 QS sequence is:
[0070] TTGTCCATCTTGTCGTCTTCGGAAATGT TGATAGCAAGAGGGTA CTCTGGGAGAAAAATTCCGGGTTGGCAATTG.
[0071] The upstream and downstream primers used to detect AR-V7 QS are:
[0072] AR-V7 QS forward primer (ie upstream primer): TTGTCCATCTTGTCGTCTTCG
[0073] AR-V7 QS reverse primer (i.e. downstream primer): CAATTGCCAACCCGGAATTT
[0074] The upstream and downstream primers used to detect AR-V7 are:
[0075] AR-V7 forward primer (ie upstream primer): TTGTCCATCTTGTCGTCTTCG
[0076] AR-V7 reverse primer (i.e. downstream primer): CAATTGCCAACCCGGAATTT
[0077] 1.2 AR-V7 probe: 5'-TATGAAGCAGGGATGA-3', the 5' end is labeled with FAM, and the probe sequence of the internal standard AR-V7 QS is designed by adjusting the base sequence according to the probe sequence of AR-V7, AR ...
Embodiment 2
[0092] Example 2 AR-V7 QS primer pair concentration screening
[0093] 2.1 Since AR-V7 and AR-V7 QS share primers, there will be competitive inhibition between the two. Therefore, we need to optimize and adjust the primer concentration to minimize the effect of this competitive inhibition. In this test, 22RV1 cell line RNA was used as the template, and the final concentrations of AR-V7 primer pairs and probes were 200nM and 100nM respectively. The probe concentration was kept constant at 100nM, and the effect of the primer concentration on the detection results was investigated.
[0094] 2.2 The AR-V7 detection process is shown in Example 1;
[0095] 2.3 Analysis of test results
[0096]With the same amount of internal standard and 22RV1 RNA sample, the concentration of primers increased, the detection Ct value of AR-V7 and AR-V7 QS did not change significantly, and the signal value of AR-V7 and AR-V7 QS detection increased with the concentration of primers. increase, AR-V...
Embodiment 3
[0097] Example 3 internal standard AR-V7 QS dosage screening
[0098] 3.1 Due to the competitive inhibition between the detection of AR-V7 and the internal standard AR-V7 QS, it is necessary to optimize and adjust the dosage of the internal standard AR-V7 QS to meet the needs of AR-V7 detection. If the AR-V7 QS is too low, the detection of high concentration AR-V7 will significantly inhibit the detection of AR-V7QS; if the AR-V7 QS is too high, the detection of low concentration AR-V7 may be affected by the detection of AR-V7 QS Impact. Based on this, we set up four template quantity gradients for AR-V7 QS (here the template quantity is quantified by ddPCR), and T1 (5000copies), T2 (500copies), T3 (50copies) and T4 (5copies) were tested in turn. .
[0099] 3.2 The AR-V7 detection process is shown in Example 1;
[0100] 3.3 Analysis of test results
[0101] For AR-V7, three different AR-V7 template amounts were used for detection (each concentration was detected twice in pa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


