A method for efficient knockout of cd96 gene in nk cells

A high-efficiency technology for NK cells, applied in the field of gene editing, to achieve high knockout efficiency, improved recognition and killing activity, obvious application prospects and clinical application value

Active Publication Date: 2022-07-22
SHANGHAI UNIV OF T C M
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CRISPR / Cas9 is a new type of nuclease system derived from prokaryotes. It consists of two elements, the guide sequence sgRNA and the nuclease Cas9. At present, the CRISPR / Cas9 system has been successfully used in humans, mice, zebrafish, and Arabidopsis. , rice, Drosophila, silkworm and other species have achieved gene knockout, but so far there is no related report on the knockout of CD96 gene in NK cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for efficient knockout of cd96 gene in nk cells
  • A method for efficient knockout of cd96 gene in nk cells
  • A method for efficient knockout of cd96 gene in nk cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] A method for efficiently knocking out CD96 gene in NK cells, comprising the following specific steps:

[0035] 1. Expansion and culture of NK cells

[0036] 1) Take out the cryopreserved human peripheral blood mononuclear cells (PBMC) from liquid nitrogen and thaw rapidly in a 37°C water bath;

[0037] 2) Add 4 mL of RPMI-1640 complete culture medium containing 10% FBS and 1% penicillin / streptomycin double antibody to a new 15 mL centrifuge tube, and transfer 1 mL of PBMC suspension to a 15 mL centrifuge tube;

[0038] 3) Centrifuge at 250 × g for 5 min at room temperature;

[0039] 4) Discard the supernatant and resuspend the cells with 1 mL of RPMI-1640 medium;

[0040] 5) Add 19mL RPMI-1640 culture solution to a new 75mL cell culture flask, and transfer the above cell suspension to the culture flask;

[0041] 6) Add human recombinant IL-2 protein to the culture flask, and the final concentration is 200U / mL;

[0042] 7) Put the culture flask at 37°C, 5% CO 2 In t...

Embodiment 2

[0073] Gene knockout efficiency was detected by flow cytometry:

[0074] 1) Collect wild-type or CD96 knockout NK cells and wash twice with 1×PBS containing 1% fetal bovine serum (FBS);

[0075] 2) Resuspend the cells in PBS containing 1% FBS and count, and adjust the cell concentration to 3×10 6 pcs / mL;

[0076] 3) Add 50 μL of the above cell suspension into a new 1.5 mL centrifuge tube, add 1 μL of PE-anti TIGTI antibody, and incubate at 4°C for 30 min in the dark;

[0077] 4) Wash twice with 1% FBS 1×PBS;

[0078] 5) Resuspend the cells with 300 μL of 1% FBS 1×PBS and perform flow cytometry detection.

[0079] Test results such as Figure 2A and 2B shown, by Figure 2A and 2B It can be seen from the results shown: sgRNA-5, 9 and 10 have higher knockout efficiency, as shown in Table 1:

[0080] Table 1 Detection of CD96 knockout efficiency by flow cytometry

[0081]

[0082]

[0083] It can be seen from the results in Table 1: under the same conditions, the sg...

Embodiment 3

[0085] The phosphorylation-modified gRNA targeting CD96 was purchased from GenScript Biotechnology Co., Ltd., and the specific phosphorylation sites were: 3 thio groups and methoxy groups at the 3' and 5' ends respectively.

[0086] CD96-10: GCTGTCTATCATCCCCAATA

[0087] Depend on image 3 The results shown are: the percentage of CD56+ / CD96+ NK cells in wild-type NK cells is 96.5%, and the CD96-10 gRNA modified by phosphorylation can reduce the percentage of CD56+ / CD96+ NK cells to 67.4% without phosphorylation modification. The CD96-10 gRNA can only be reduced to 90.4%, indicating that the phosphorylation-modified sgRNA has better stability and stronger activity. The specific results are shown in Table 2:

[0088] Table 2 Detection of CD96 knockout efficiency by flow cytometry

[0089] name Percentage of CD56+ / CD96+ NK cells (%) Knockout rate (%) WT 96.5 0 Phosphorylated CD96-10 67.4 29.1 Unmodified CD96-10 90.4 6.1

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for efficiently knocking out the CD96 gene in NK cells. The method uses a CRISPR / Cas9 gene editing system to introduce a complex of sgRNA and Cas9 protein into amplified NK cells by electroporation transfection wherein: the sequence of the sgRNA is selected from any one of the sequences shown in SEQ ID NO.1-10. The method of the present invention can realize the knockout of CD96 gene in NK cells, not only the knockout efficiency is high, but also the obtained NK cells that do not express CD96 can relieve the immunosuppressive effect of CD155+ tumor cells on NK cells. Wild-type NK cells show stronger anti-tumor activity in both in vivo and in vitro experiments, significantly improving the recognition and killing activities of NK cells on tumor cells, and are expected to be developed into safe and effective anti-tumor biological agents.

Description

technical field [0001] The invention relates to a method for efficiently knocking out CD96 gene in NK cells, and belongs to the technical field of gene editing. Background technique [0002] Natural killer cells (NK cells) are important immune cells in the body. They are derived from bone marrow lymphoid stem cells. Their differentiation and development depend on the bone marrow and thymus microenvironment. They are mainly distributed in bone marrow, peripheral blood, liver, spleen and lung. and lymph nodes. Different from T and B cells, NK cells are a type of lymphocytes that can non-specifically kill tumor cells and virus-infected cells without prior sensitization. It is not only related to anti-tumor, anti-viral infection and immune regulation, but also in some cases. It is involved in the occurrence of hypersensitivity reactions and autoimmune diseases, and can recognize target cells and killing mediators. [0003] Studies have shown that although NK cells have powerfu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N5/0783C12N15/85C12N15/113C12N15/10
CPCC12N5/0646C07K14/47C12N15/85C12N15/113C12N15/10C12N2310/20
Inventor朱诗国姚超于文霞
OwnerSHANGHAI UNIV OF T C M