Supercharge Your Innovation With Domain-Expert AI Agents!

Gene GhBLH1 for controlling fiber elongation of cotton and application of gene GhBLH1

A gene and transgenic cell line technology, applied in the field of cotton genetic engineering, can solve problems such as unclear gibberellin signaling pathways

Pending Publication Date: 2021-01-22
SHAANXI NORMAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These studies have shown that the gibberellin signaling pathway is closely related to the development of cotton fiber cells, but how the gibberellin signaling pathway regulates the process of cotton fiber development is not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene GhBLH1 for controlling fiber elongation of cotton and application of gene GhBLH1
  • Gene GhBLH1 for controlling fiber elongation of cotton and application of gene GhBLH1
  • Gene GhBLH1 for controlling fiber elongation of cotton and application of gene GhBLH1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Expression patterns of GhBLH1 gene at different stages of cotton fiber development

[0034] 1. Extract the RNA of 0DPA, 3DPA, 5DPA, 10DPA, 15DPA, and 20DPA fiber tissue in different stages of Xuzhou cotton 142 fiber development, reverse transcribe into the first strand cDNA, and design primers according to the dominant gene sequence, GhBLH1-QRT-F: C C A A GG A G T A G C G T C A A T G A G T and G h B L H 1-Q R T-R: C C A C T A C C G G TA T T A T C A G T T C C T for Q-PCR amplification.

[0035] 2. The procedure used to complete the above experiment was pre-denaturation at 95°C for 15s; denaturation at 95°C for 5s, refolding at 60°C for 34s, extension at 72°C for 40s (data receiving); a total of 40 cycles.

[0036] 3. The internal reference gene used to complete the above experiments is GhUBQ7, and the primer sequences are GhUBQ7-F: GGCATTCACCTGACCAACAA, GhUBQ7-R: CCGCATTAGGGCACTCTTTTC.

[0037] 4. For each of the above reactions, 3 biological repeats and 3 te...

Embodiment 2

[0040] Example 2: Phenotypic identification of GhBLH1 overexpression Arabidopsis and mutation complementation

[0041] 1. Construction of recombinant plasmid pBI121-GhBLH overexpression

[0042] 1. Use primers to amplify the target gene fragments, and the primer sequences are shown in the table below.

[0043] Primers were designed using the cotton genome (https: / / cottonfgd.org / ) sequence as a reference, and the full-length GhBLH1 gene was obtained by PCR amplification. Using the cDNA of cotton 15-day fiber (cotton fiber tissue after 15 days of cotton flowering) as a template, the full-length GhBLH1 gene with enzyme cleavage sites was amplified, and the first 9 nucleotides in the primers in the following table are protected bases and enzymes cutting site, the sequence of the target gene is underlined,

[0044]

[0045] 2. Homologous recombination method The target gene fragment was connected to the vector pBI121 to obtain the recombinant plasmid pBI121-GhBLH.

[0046] 3....

Embodiment 3

[0050] Example 3: Obtaining and Phenotypic Analysis of GhBLH1 Transgenic Cotton Plants

[0051] 1. Construction of recombinant plasmid pBI121-GhBLH overexpression

[0052] 1. Obtain the target gene fragment with primer amplification, and the primer sequence is the same as in Example 2.

[0053] Using the cDNA of cotton 15-day fiber as a template, the GhBLH1 gene fragment with vector homology arms was amplified.

[0054] 2. Homologous recombination method The target gene fragment was connected to the vector pBI121 to obtain the recombinant plasmid pBI121-GhBLH.

[0055] 3. Introducing the recombinant plasmid pBI121-GhBLH into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium.

[0056] 2. Construction of recombinant plasmid pHellsgate4-GhBLH gene interference vector

[0057] 1. Amplify a specific fragment of an approximately 500bp target gene with primers comprising an adapter sequence.

[0058] 2. Connect to the RNAi interference vector pHellsgate4 by BPa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Lengthaaaaaaaaaa
Lengthaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of cotton gene engineering, and discloses a GhBLH1 gene for controlling fiber elongation development of cotton and application of the GhBLH1 gene, and the nucleotidesequence of the gene is as shown by SEQ ID No.1. The GhBLH1 gene disclosed by the invention is introduced into the cotton to perform overexpression to obtain transgenic cotton with elongated fiber cells. The gene provides a new thought for the fiber development mechanism of the cotton, and has important significance in cultivating excellent cotton fiber varieties or researching.

Description

technical field [0001] The invention belongs to the field of cotton genetic engineering, and specifically relates to gene GhBLH1 and its application in regulating cotton fiber cell elongation. Background technique [0002] Existing studies have shown that gibberellin plays an important role in the process of cotton fiber development. Exogenous application of gibberellin can significantly promote the initiation and elongation of fiber cells, while exogenous application of gibberellin synthesis inhibitor paclobutrazol can significantly inhibit fiber development [1] . Two key proteins GID1 and SLR1 in the gibberellin signaling pathway are specifically expressed in fibroblasts [2] . GhSLR1 can interact with GhGID1 and respond to gibberellin treatment, and overexpression of GhSLR1 leads to dwarfing of Arabidopsis plants and increased expression of gibberellin-responsive genes [3] . In addition, overexpression of the key enzyme GA20-oxidase (GA20ox) in the synthesis of gibber...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N5/10A01H5/10A01H6/60A01H6/20
CPCC07K14/415C12N15/8218C12N15/8261
Inventor 何鹏俞嘉宁肖光辉
Owner SHAANXI NORMAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com