High-specificity loop-mediated isothermal amplification (LAMP) method and application thereof

A loop-mediated isothermal and high-specificity technology, applied in the field of warm amplification, can solve problems such as difficulty in identifying the target source specificity of amplified products, LAMP application limitations, cross-contamination of samples to be tested, etc., and achieve high-efficiency pollution degradation capabilities, It is convenient and quick to change the design, and the effect of increasing time

Pending Publication Date: 2021-02-02
SOUTH CHINA NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Nevertheless, it has the following problems: First, because LAMP has ultra-high sensitivity, a large amount of long-chain DNA is produced in the reaction process, and a part of it will form an aerosol and release into the air when the cover is opened, and each aerosol contains at least there are 10 6 Copy of the target gene, resulting in cross-contamination of the sample to be tested, resulting in false positive results
However, most of the conventional detection methods of LAMP amplification products are based on the detection of double-stranded DNA products or by-products of the polymerization reaction, which can only determine whether the amplification reaction has occurred, and it is difficult to identify the target source and specificity of the amplification product.
These problems limit the application of LAMP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-specificity loop-mediated isothermal amplification (LAMP) method and application thereof
  • High-specificity loop-mediated isothermal amplification (LAMP) method and application thereof
  • High-specificity loop-mediated isothermal amplification (LAMP) method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] A highly specific loop-mediated isothermal amplification method

[0044] (1) Design the amplification primers: add the complementary site NCC of PAM in the middle of the FIP / BIP primer of the conventional LAMP amplification method, so that the product of CUT-LAMP contains the PAM site NGG, which can be effectively recognized and cut by Cas9 / sgRNA.

[0045] (2) Design sgRNA so that the Cas9 / sgRNA complex can specifically recognize and cut the amplification product without cutting the target.

[0046] In this embodiment, the DNA template primer sequence for in vitro transcription of sgRNA includes a forward primer and a reverse primer;

[0047] The above primers were subjected to PCR amplification. The reaction system was as follows. The reaction was carried out in a thermal cycle PCR instrument. The PCR amplification program was: denaturation at 95°C for 20 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 15 seconds. The above procedures were carried ...

Embodiment 2

[0070] Application of a highly specific loop-mediated isothermal amplification method in the detection of invA gene of Salmonella typhimurium

[0071] The gene sequence is as follows (SEQ ID NO: 1): 5'-GATATTGCCTACAAGCATGAAATGGCAGAACAGCGTCGTACTATTGAAAAGCTGTCTTAATTTAATATTACAGGATACCTATAGTGCTGCTTTCTCTACTTAACAGTGCTCGTTTACGACCTGAATTACTGATTCTGGTACTAATGGTGATGATCATTTCTATGTTCGTCATTCATTACCTACCTACCGGTTGATTGATGATC GGCGATATTGGTGTTTATGGG GTCGTTTCTACATTGACAGAATCCTC AGTTTTTCAACGTTTCCTGCGG TACT GTTAATTACCACGCTCTTTCGTC TGGCATT ATCGATCAGTACCAG TC GTCTTATCTTGATTGAAGCC GATGCCGGTGAAATTATCGC CACGTTCG GGCAATTCGTTATTGGCGATAGCCTG GCGGTGGGTTTTGTTGTCTTCTCT ATTGTCACCGTGGTC CAGTTTATCGTTATTACCAAAGGTTCA GAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATT-3’(划横线部分为引物靶向区域,且划线区域依次为F3,F2,LF,F1c,B1,LB,B2C,B3)

[00...

Embodiment 3

[0101] Application of a highly specific loop-mediated isothermal amplification method in Neisseria meningitidis (conserved gene ctrA)

[0102] The gene sequence of ctrA is as follows:

[0103] 5’-GTGTTTAAAGTGAAATTTTATATTCGTCACGCAGTATTATTATTGTGTGGAAGTTTAATTGTAGGATGCTCTGCGATTCCTTCATCAGGCCCCAGCGCAAAAAAAATTGTCTCTTTAGGGCAACAATCTGAAGTTCAAATTCCTGAAGTGGAGCTGATTGATGTGAATCATACGGTTGCTCAGTTATTATATAAGGCTCAGATAAATCAGTCATTCACTCAGTTTGGCGATGGTTATGCTTCGGCTGGTACGCTAAATATTGGTGATGTATTGGATATTATGATTTGGGAAGCGCCGCCGGCAGTATTGTTTGGTGGTGGCCTTTCTTCGATGGGCTCGGGTAGTGCGCATCAAACTAAGTTGCCAGAGCAGTTGGTCACGGCACGTGGTACGGTTTCTGTGCCGTTTGTTGGCGATATTTCGGTGGTCGGTAAAACGCCTGGTCAGGTTCAGGAAATTATTAAAGGCCGCCTGAAAAAAATGGCCAATCAGCCACAAGTGATGGTGCGTTTGGTGCAGAATAATGCGGCGAATGTGTCGGTGATTCGTGCTGGGAATAGTGTGCGTATGCCGCTGACGGCAGCCGGTGAGCGTGTGTTGGATGCGGTGGCTGCGGTAGGTGGTTCAACGGCAAATGTGCAGGATACGAATGTGCAGCTGACACGTGGCAATGTAGTACGAACTGTTGCCTTGGAAGATTTAGTTGCAAATCCGCGACAAAATATTTTGCTGCGTCGCGGTGATGTGGTTACCATGATTACCAATCCCTATACCTTTACGTCTATGGGTGCGGTGGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a high-specificity loop-mediated isothermal amplification (LAMP) method. The method comprises the following steps of: 1, designing an amplification primer; 2, designing sgRNA;3, carrying out amplification; and 4, carrying out specific detection of an amplification product. According to the amplification method provided by the invention, femtogram-level pollution removal can be implemented; the false positive rate of detection of the conventional LAMP method is effectively reduced; and the detection accuracy is improved. Meanwhile, the invention further discloses application of the high-specificity LAMP method to gene detection.

Description

technical field [0001] The invention relates to the field of biological detection, in particular to a highly specific loop-mediated isothermal amplification method and its application. Background technique [0002] Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification technology with fast amplification speed, controllable cost, and low equipment requirements. It was created by Notomi et al. in 2000. It relies on a DNA polymerase with strand displacement activity and four primers, and can efficiently complete high-specificity amplification reactions under isothermal conditions. At present, it has been widely used in the field of nucleic acid diagnosis, such as pathogen identification, biomarker detection, gender identification, etc. Nevertheless, it has the following problems: first, because LAMP has ultra-high sensitivity, a large amount of long-chain DNA is produced in the reaction process, and a part of it will form an aerosol and release into the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6844C12Q1/6848C12N15/113C12N15/10
CPCC12Q1/6844C12Q1/6848C12N15/111C12N2310/20C12N2330/30C12Q2531/119C12Q2525/131C12Q2521/301C12Q2525/185
Inventor 周小明鲍益娟
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap