Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Real-time fluorescence PCR detection method and detection kit of ahamus yushuensis

A real-time fluorescence and detection method technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of false positive amplification, and the difficulty of locating specific fragments of A. yushu. Achieve the effects of small genetic differences between species, accurate identification results, and shortened detection time

Active Publication Date: 2021-02-05
PLANTS & ANIMALS & FOOD TESTING QUARANTINE TECH CENT SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The technical problem to be solved in the present invention is to provide a real-time fluorescent PCR detection method for A. eucalyptus, which solves the problem that the gene sequence difference of the host insect of Cordyceps sinensis is small, the location of specific fragments of A. yushu is difficult, and false positive amplification is prone to occur. Technical problem, to reach the purpose of fast and accurate detection and identification A. yushu; For this reason, the present invention also provides the detection kit that is used for above-mentioned method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Real-time fluorescence PCR detection method and detection kit of ahamus yushuensis
  • Real-time fluorescence PCR detection method and detection kit of ahamus yushuensis
  • Real-time fluorescence PCR detection method and detection kit of ahamus yushuensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] 1. Design Primers and Probes

[0050] According to the sequence of some genes in the mtDNA (mitochondrial DNA) of A. yushu, the following primers YSF1 / YSR1 and probe YS-P1 were designed (primers and probes were synthesized by Shanghai Jikang Company):

[0051] The sequence of the primer is:

[0052] Upstream primer YSF1: 5'-CCTGTTCCTGCCCCGTTT-3', as shown in SEQ ID NO: 1;

[0053] Downstream primer YSR1: 5'- AAGATTTTGATTATTACCCCCATCAT -3', as shown in SEQ ID NO: 2;

[0054] The sequence of the probe YS-P1 is:

[0055] The probe YS-P1: 5'- CTACAATTCTCCTAGAAATT -3' of the Yushu basilisk moth probe, as shown in SEQ ID NO: 3, the fluorescent group is connected to the 5' end of the probe, and the quencher group is connected to the 3' end;

[0056] The detection principle of the above primers and probes is as follows: figure 1 shown. Probe YS-P1 is an oligonucleotide probe with a fluorophore attached to the 5' end of the probe and a quencher at the 3' end. When the prob...

Embodiment 2

[0065] 1. Designing Primers and Probes

[0066] Design the following specific primers YSF2 / YSR2 and probe YS-P2 (primers and probes disclosed in the present invention, primers and probes are provided by Shanghai Jikang according to the sequence of some genes in the mtDNA (mitochondrial DNA) of A. company synthesis):

[0067]Upstream primer YSF2: 5'-GCAGGGTCGAAAAATGAAGTATTT-3', sequence shown in SEQ ID NO: 4;

[0068] Downstream primer YSR 2: 5'- TGTGTGAAGGGTTGTAATTACTGCAT -3', the sequence shown in SEQ ID NO: 5;

[0069] The probe YS-P2 of the eucalyptus moth probe YS-P2: 5'- TAGCTCCTGCTAATACAG -3', the sequence shown in SEQ ID NO: 6;

[0070] The detection principle of the above primers and probes is as follows: image 3 shown. Probe YS-P2 is an oligonucleotide probe with a fluorophore attached to the 5' end of the probe and a quencher at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during P...

Embodiment 3

[0076] Example 3 Verification and detection sensitivity test of the specific primer YSF3 / YSR3 and probe YS-P3 of the eucalyptus moth

[0077] 1. Design the following specific primers YSF3 / YSR3 and probe YS-P3 (primers and probes disclosed in the present invention, primers and probes are provided by Shanghai Kekon Synthetic):

[0078] Upstream primer YSF3: 5'-GTTGCAAGAATTGCATCAAATG-3', sequence shown in SEQ ID NO: 7;

[0079] Downstream primer YSR3: 5'-CAATTATGGGCCTTTACGATCT-3', sequence shown in SEQ ID NO: 8;

[0080] The probe YS-P3 of the yushu lynch moth probe YS-P3: 5'- AAATTTATAATAGCCAAAGCTATT-3', the sequence shown in SEQ ID NO: 9;

[0081] The detection principle of the above primers and probes is as follows: Figure 5 shown. Probe YS-P3 is an oligonucleotide probe with a fluorophore attached to the 5' end of the probe and a quencher at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; duri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a real-time fluorescence PCR detection method and a detection kit of ahamus yushuensis. The real-time fluorescence PCR detection method of the ahamus yushuensis is establishedby designing a specific primer YSF3 / YSR3 and a probe YS-P3 according to the sequence of partial genes of the mtDNA of the ahamus yushuensis, so that the aims of quickly and accurately detecting and identifying the ahamus yushuensis and accurately distinguishing the ahamus yushuensis in various cordyceps sinensis host insects can be achieved.

Description

technical field [0001] The invention relates to the technical field of traditional Chinese medicinal materials and plant quarantine, in particular to a real-time fluorescent PCR detection method for the eucalyptus moth. In addition, the invention also relates to a kit for real-time fluorescent PCR detection of the eucalyptus moth. Background technique [0002] Ahamus yushuensis (Chu et Wang, 1985), belonging to the genus Ahamus of the family Hepialidae in the order Lepidoptera, is the host insect of Cordyceps sinensis, which is a traditional precious Chinese medicine in my country It is included in the Chinese Pharmacopoeia and is known as one of the "Three Treasures of Traditional Chinese Medicine". In my country, it is only distributed in parts of Tibet, Qinghai, Sichuan, Yunnan, and Gansu on the Qinghai-Tibet Plateau. At the same time, the host insects of Cordyceps sinensis have obvious geographical distribution characteristics of species. Usually, the host insects of Cord...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/686C12Q1/6888C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2531/113C12Q2561/113C12Q2563/107
Inventor 刘静远印丽萍张宁易建平
Owner PLANTS & ANIMALS & FOOD TESTING QUARANTINE TECH CENT SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com