MSH6 gene with mutation at 12759 site and application thereof

[0020] Example 1 Discovery of a specific MSH6 mutated gene as a causative gene for HR

[0021] figure 1The HR family with the earliest detected MSH6 gene mutation (family #1), II1 and II2 were consanguineous (II1 was an only child with deceased parents). Among them, both siblings III1 and III2 showed symptoms of short stature and rickets, and had the characteristics of hypophosphatemia and increased urinary phosphorus. They were clinically diagnosed as HR. In addition to HR, III1 (the proband, marked with an arrow) was diagnosed with stage III colorectal cancer at the age of 24 in 2018, and underwent surgical resection of the tumor, but recurrence occurred six months after the operation. The family history investigation revealed that both III1 and III2 in the #1 family were HR patients, and III1 was diagnosed with colorectal cancer, with certain genetic indications and predispositions to cause disease. In order to guide the follow-up treatment of colorectal cancer patients III1, analyze potential genetic risk factors and assess the risk of rebirth of HR children in the family (mainly referring to the marriage and childbirth of II2's son III1 and daughter III2 and the rebirth of II2's sister II3). Fertility), blood samples of II1, II2, III1 and III2 and postoperative paraffin tissue samples of III1 (10 pieces of pathological FFPE sections of 1cm×1cm) were first collected with the informed consent of the patient’s family, and sent to Shanghai Jikai Gene Ltd. performed whole-exome sequencing analysis. The basic process is as follows: the QIAamp DNA Blood Mini Kit and QIAamp DNA FFPE Tissue Kit from Qiagen, Germany were used to extract genomic DNA from blood and paraffin samples, respectively, and the SeqCap EZ Exome Kit V3 from Roche was used for whole exome capture. , and sequenced on the HiSeq 4000 second-generation sequencer (Illumina, USA), and compared the human reference genome hg19 to obtain gene mutation information. The sequencing depth of blood samples is required to be >50×, and the sequencing depth of paraffin samples is required to be >250×.

[0022] The final sequencing results showed that the coverage of the target capture area was >99.5%, the average sequencing depth of blood samples was 64×, and the average sequencing depth of paraffin section samples was 281×. For III1, the DNA sequencing information of surgically resected tumor samples was analyzed based on the genomic DNA information (ie, its own genome) measured in blood samples and the human reference genome hg19, and more than a dozen major gene mutations (mutations) were found. ratio>1%), including the g.[7785-7788delGTGA] mutation in the MSH6 gene, which is also present in its genomic DNA (blood samples detected both wild-type MSH6 gene and g.[7785-7788delGTGA] ] mutant MSH6 gene and the two account for about 50% each, in essence, the two are alleles of each other). Combining the genomic results of II1, II2 and III2 detected by blood samples, it was found that the g.[7785-7788delGTGA] mutation of the MSH6 gene also exists in the genomes of these three. The difference is that only g is detected in III1 and III2. .[7785-7788delGTGA] mutant MSH6 gene, while both II1 and II2 detected wild-type MSH6 gene and g.[7785-7788delGTGA] mutant MSH6 gene (and wild-type and mutant genes each accounted for about 50%). All samples with MSH6 gene g.[7785-7788delGTGA] mutation detected by whole exome capture sequencing were subjected to Sanger sequencing to verify the detection result of g.[7785-7788delGTGA] mutation. Except for the g.[7785-7788delGTGA] mutant MSH6 gene shared with III1, no other significant mutations were detected in the II1, II2 and III2 genomes, that is, the g.[7785-7788delGTGA] mutant MSH6 gene was present in this HR family In all members of the two generations, it is speculated that the g.[7785-7788delGTGA] mutant MSH6 gene is the causative gene of HR, and the distribution of this gene in pedigree #1 was further examined.

[0023] Blood samples from members I1, I2, II3, II4, and III3 of family #1 were collected to detect mutations in the MSH6 gene. In order to save costs, further detection was performed by PCR-capture sequencing of the MSH6 gene. The sequence within the range of 47783145-47806954 in the DNA fragment of NCBI accession number NC_000002.12 (the 47783145th site is the first site of the MSH6 gene, including the start and end points in total 23810bp) is the human MSH6 gene reference sequence (as of 2020.11.1 information) ), on this basis, combined with the previous whole exome sequencing results of family #1 members, the PCR capture probes shown in Table 1 were designed to perform multiplex PCR-based capture and sequencing analysis on the MSH6 gene. The target region of MSH6 gene captured by the PCR capture primer set shown in Table 1 is not limited to the region where the four kinds of mutations occur, but covers all exon regions of MSH6 gene and the junction region of exons and introns. It is beneficial to be able to fully discover other mutations in the MSH6 gene. The multiplex PCR amplification system (reagents from Lifetech, USA, operate with reference to the manual system method) and conditions are shown in Table 2. The multiplex PCR amplification products were sent to Shanghai Sangon Bioengineering Co., Ltd. for second-generation sequencing analysis, and the detected mutations were all Sanger sequencing is required for verification (g. The Sanger sequencing map at the [7785-7788delGTGA] mutation site is shown in Figure 7 ). The MSH6 gene mutation of each member in family #1 is shown in Table 3.

[0024] Table 1 PCR capture sequencing primer set of MSH6 gene

[0025] Amplicon number Primer upstream sequence (5'-3') upstream sequence identifier Primer downstream sequence (5'-3') downstream sequence identifier Amplicon1 AGATTTCCCGCCAGCAGGGAG SEQ ID NO: 5 CTGCACTCATTCAAGCCAACTC SEQ ID NO: 6 Amplicon2 CTTTTGGAGGGAGGAGACGC SEQ ID NO: 7 CTACCTACCGAAGGACCCAG SEQ ID NO: 8 Amplicon3 TGTAGGTAACTGCCTTTAAGGA SEQ ID NO: 9 GTCTGCCTGTCTGTCTGTTTC SEQ ID NO: 10 Amplicon4 CTTGAACTGCTGGGATTACAG SEQ ID NO: 11 CAGGGAACTACAGAAGTATGC SEQ ID NO: 12 Amplicon5 AGTTGAACTGTCTTACATTATGG SEQ ID NO: 13 CTAACGTGGGCTTGGGATTCA SEQ ID NO: 14 Amplicon6 TGGAGGTGGTGATGACAGTAG SEQ ID NO: 15 TTCTCAGAGGGATCACCTTCCA SEQ ID NO: 16 Amplicon7 CTACAGTAAGTATCTTCTTAGCC SEQ ID NO: 17 GACTGTGTCAGAATCCAAGGGA SEQ ID NO: 18 Amplicon8 AGCACTACAAGATCTGGTGCTA SEQ ID NO: 19 ATCAGGAAAACGACCTTCAGGA SEQ ID NO: 20 Amplicon9 TTGACTGTAGAATTGAACCGATG SEQ ID NO: 21 ACAAGCTTGTTCAAAGTCTTACC SEQ ID NO: 22 Amplicon10 ATGAAGCCTCACTTTTTACCCTC SEQ ID NO: 23 ACTGTGTTTGGAAAATGATCACC SEQ ID NO: 24 Amplicon11 GACCTTTTCCTCCCCTCATTCAC SEQ ID NO: 25 AATTATTGGCCGGGCACGGTT SEQ ID NO: 26 Amplicon12 GCTCATGATAGCTATATAACCTA SEQ ID NO: 27 TCCAACTATCGGTCTGTGCCA SEQ ID NO: 28 Amplicon13 CTTTAACAGGAAGAGGTACTGC SEQ ID NO: 29 GTTAGTTAGTTACCGAAATAATCG SEQ ID NO: 30 Amplicon14 CTAACTGACCTTAAGTTTCAAAG SEQ ID NO: 31 CCACCTTTGTCAGAAGTCAAC SEQ ID NO: 32

[0026] Table 2 PCR capture amplification system and conditions

[0027]

[0028]

[0029] Table 3 MSH6 gene mutation in each member of family #1

[0030]

[0031] It can be seen from Table 3 that in the #1 family, the disease (III1 and III2) is only caused by the homozygous mutation of MSH6 (g.[7785-7788delGTGA] mutation), and carrying the MSH6 mutant gene and the wild-type MSH6 gene at the same time does not cause disease. disease (I1, II1, II2, II3, and III3), only the wild-type MSH6 gene is not pathogenic (I2 and II4), and the pathogenic mutations are inherited from parents to children, in line with an autosomal recessive inheritance pattern ( It has nothing to do with gender, and the MSH6 gene is located on autosome 2), that is, the MSH6 mutant gene is a recessive pathogenic gene and the MSH6 mutant gene and the MSH6 wild-type gene are alleles of each other. Assuming that the MSH6 wild-type gene is A and the MSH6 mutant gene is a, then according to the results of genetic testing, the genotypes of each member of family #1 are as follows figure 1 and shown in Table 3. Depend on figure 1 The gene transmission law of the family can be intuitively seen that it is a typical autosomal recessive inheritance. The phenotype and genotype are consistent, that is, the genotype determines the phenotype, and the phenotype is co-segregated with the genotype. In conclusion, the g.[7785-7788delGTGA] type MSH6 mutation gene is a new autosomal recessive pathogenic gene for HR (not reported). On this basis, further collect HR families for verification.

[0032] Example 2 Expanded Family Validation

[0033] 5 HR families (numbered #2-#6) were further collected, which satisfied that there were more than 2 HR members in the family, and the family map showed the possibility of autosomal recessive inheritance. According to the PCR capture and sequencing method (Table 1 and Table 2) in Example 1, the blood samples of HR patients and related members in the family were subjected to MSH6 gene mutation detection, and the results are shown in Table 4 (for the convenience of summary analysis, Example 1 Family #1 results in are also included).

[0034] Table 4 MSH6 gene mutation in 6 HR families

[0035]

[0036] From the MSH6 gene detection of pedigree #2-#6, 3 new mutation types were found, namely g.[7957inAA], g.[12759inTTAAG] and g.[12907inCAGC] (verified by Sanger sequencing). These three MSH6 mutant genes are all causative genes for HR (see Table 4 and Figure 2-Figure 6 ). In combination with the identification of family #1 in Example 1, the wild-type MSH6 gene is identified with A, the g.[7785-7788delGTGA] mutant MSH6 gene is identified with a, and then the letters b, c and d are used to identify g.[7957inAA], g .[12759inTTAAG] and g.[12907inCAGC] mutant MSH6 gene, wild-type MSH6 gene and four mutants of g.[7785-7788delGTGA], g.[7957inAA], g.[12759inTTAAG] and g.[12907inCAGC] MSH6 genes are alleles of each other. The specific analysis is as follows:

[0037] For family #2, both g.[7957inAA] and g.[12759inTTAAG] mutations in MSH6 gene were detected in HR patient II1, belonging to the compound heterozygous mutation genotype (bc), which were inherited from their father I1 (g. [12759inTTAAG] mutation, genotype Ac) and mother II2 (g. [7957inAA] mutation in MSH6 gene, genotype bb), whose mother II2 is a homozygous mutant genotype (bb), is also a patient with HR. Therefore, the HR of family #2 conformed to the genotype-determining phenotype, and the phenotypes achieved co-segregation with the genotypes. The inheritance mode of the HR causative gene was autosomal recessive. Thus, the g.[7957inAA] and g.[12759inTTAAG] mutant MSH6 genes are both autosomal recessive pathogenic genes for HR.

[0038] The analysis of family #3 is similar to that of family #2. In family #3, I1 and I2 are consanguineous marriages. I1, I2 and II1 were all detected to contain the g.[7957inAA] mutation of the MSH6 gene, and all three were homozygous mutant genotypes. (genotype bb), both the father I1 and the mother I2 of HR patient II1 each inherited the disease-causing gene mutation to II1 causing its disease. Therefore, the HR of family #3 conformed to the genotype-determining phenotype, and the phenotypes achieved co-segregation with the genotypes. The inheritance mode of the HR causative gene was autosomal recessive. Thus, the g.[7957inAA] mutant MSH6 gene is an autosomal recessive pathogenic gene for HR.

[0039] Family #4 was analyzed similarly to Family #2. Both HR patients II1 and II2 were found to be homozygous for the g.[12759inTTAAG] mutation in MSH6 (genotype cc), and the causative gene mutation was inherited from their father (genotype Ac) and Mother (genotype Ac). Therefore, the HR of family #4 conformed to the genotype-determining phenotype, and the phenotypes achieved co-segregation with the genotypes, and the inheritance mode of the HR causative gene was autosomal recessive. Thus, the g.[12759inTTAAG] mutant MSH6 gene is an autosomal recessive pathogenic gene for HR.

[0040]Family #5 was analyzed similarly to Family #2. Both the g.[7957inAA] and g.[12907inCAGC] mutations of the MSH6 gene were detected in HR patients II1 and II2, which belonged to the compound heterozygous mutation genotype (bd), which were inherited from their Father I1 (g.[12907inCAGC] mutation in MSH6 gene, genotype dd) and mother II2 (g.[7957inAA] mutation in MSH6 gene, genotype Ab), whose father I1 is a homozygous mutant genotype (dd), is also HR patients. Therefore, the HR of family #5 conformed to the genotype-determining phenotype, and the phenotypes achieved co-segregation with the genotypes. The inheritance mode of the HR causative gene was autosomal recessive. It can be seen that the g.[7957inAA] and g.[12907inCAGC] mutant MSH6 genes are both pathogenic genes of HR.

[0041] Family #6 was analyzed similarly to Family #2. HR patient III1 was found to contain both g.[12759inTTAAG] and g.[12907inCAGC] mutations in the MSH6 gene, belonging to the compound heterozygous mutation genotype (cd), inherited from her mother II1, respectively. (g.[12759inTTAAG] mutation in MSH6 gene, genotype cc, HR patient) and paternal II2 (g.[12907inCAGC] mutation in MSH6 gene, genotype Ad); further, III1 pathogenic gene mutation in paternal II2 (MSH6 The gene g.[12907inCAGC] mutation) was inherited from I2 (genotype dd, HR patient). Therefore, the HR of family #6 conformed to the genotype-determining phenotype, and the phenotypes achieved co-segregation with the genotypes. The inheritance mode of the HR causative gene was autosomal recessive inheritance. It can be seen that the g.[12759inTTAAG] and g.[12907inCAGC] mutant MSH6 genes are both pathogenic genes of HR.

[0042] Three novel mutations, g.[7957inAA], g.[12759inTTAAG], and g.[12907inCAGC], were discovered by PCR-capture sequencing targeting the MSH6 gene, allowing genetic analysis of the HRs of pedigrees #2-#6. For the sake of rigor, all HR patients in these 5 families were selected for whole-exome sequencing verification, and it was found that the type and proportion of mutated genes were consistent with the results of PCR-captured sequencing. Taking HR patient II1 in family #2 as an example, whole exome sequencing also found only g.[7957inAA] and g.[12759inTTAAG] mutations in MSH6 gene (other than other obvious gene mutations), And the two accounts for about 50% each, which is consistent with the results of PCR capture and sequencing for MSH6 gene. This further confirmed that the MSH6 gene of a specific mutation type was the causative gene of HR.

[0043] In summary, MSH6 mutant genes with g.[7785-7788delGTGA], g.[7957inAA], g.[12759inTTAAG] and g.[12907inCAGC] mutations are all pathogenic genes for HR, and any homozygous mutation or any A compound heterozygous mutation genotype can lead to the occurrence of HR, and all of them are autosomal recessive. According to the literature, MSH6 gene encodes a mismatch repair protein, which has the function of participating in DNA base mismatch repair. It can participate in the recognition and binding to the mismatch site and start the repair, and then complete it together under the action of other mismatch repair-related enzymes. Repair process of mismatched sites. Previous studies have shown that the MSH6 gene may play a role in the occurrence and development of tumors, but there is no research report showing that this gene is associated with HR, and there is no research report that this gene is related to the absorption and metabolism of phosphorus in vivo. It is worth noting that in the HR families and populations containing MSH6 gene mutations collected by the inventors, the overall incidence of tumors was significantly higher than the average level of the normal population.

[0044] Example 3 HR population sample verification

[0045] On the basis of Examples 1 and 2, the MSH6 gene mutation was further detected in the HR population. Twenty-seven clinically diagnosed HR patients (numbered S1-S27), 16 male patients and 11 female patients, aged 26.3 years (4-57 years old) were collected. According to the PCR capture and sequencing method (Table 1 and Table 2) in Example 1, under the condition of full informed consent of these HR patients, their blood samples (peripheral venous anticoagulation 2ml) were collected for MSH6 gene mutation detection, and the results are shown in Table 5 shown. Among them, only HR patients of S1-S17 were detected to contain specific mutations of MSH6 gene, while HR patients of S18-S27 were not detected to contain any MSH6 gene mutations, indicating that there are other known or unknown gene mutations that can cause HR Occurs (eg PHEX mutation on the X chromosome). Only g.[7785-7788delGTGA], g.[7957inAA], g.[12759inTTAAG] and g.[12907inCAGC] mutations of MSH6 gene were detected in HR patients of S1-S17, and no other loci of MSH6 gene were detected. mutation. Among them, 5 HR patients contained homozygous mutations of 3 MSH6 genes (S1, S9, S13-S15), and the involved genotypes included aa, bb, and cc; the remaining 12 HR patients contained compound heterozygous mutations of all 6 MSH6 genes. The genotypes involved include ab, ac, ad, bc, bd and cd, see Table 5 for details.

[0046] Table 5 MSH6 gene mutation in HR patient population

[0047]

[0048] Note: The + sign in Table 5 indicates that the corresponding mutation was detected, and the empty or - indicates that no mutation was detected.

[0049] For the 4 MSH6 gene specific mutations detected in HR patients of S1-S17 in Table 5, PCR primers were designed to amplify the mutant gene fragments, and the amplification primers and conditions are shown in Table 6 (the amplification system refers to the conventional PCR system), wherein The g.[7785-7788delGTGA] mutation and g.[7957inAA] mutation are located in the same exon, and the g.[12759inTTAAG] mutation and g.[12907inCAGC] mutation are located in another exon, so the same primer pair was used for amplification The fragments containing the g.[7785-7788delGTGA] mutation and the g.[7957inAA] mutation were increased, and another primer pair was used to amplify the fragments containing the g.[12759inTTAAG] mutation and the g.[12907inCAGC] mutation. After the PCR amplification products of the mutant gene fragments were verified by agarose gel electrophoresis, they were sent to Shanghai Sangon Bioengineering Co., Ltd. for Sanger sequencing verification. (The Sanger sequencing verification of the mutation results of whole exome capture sequencing and PCR capture sequencing involved in Examples 1 and 2, the PCR amplification and detection methods are the same as here). At the same time, 250 blood samples from normal people (non-HR patients) were collected as reference, and 2ml of peripheral venous anticoagulation was collected with their full informed consent. The PCR system and conditions shown in Table 6 were used to carry out amplification of MSH6 specific gene fragments. augmentation and Sanger sequencing. The results of Sanger sequencing showed that the 4 specific mutations of MSH6 gene detected in HR patients of S1-S17 were completely consistent with the PCR-captured sequencing results (including the mutation types and proportions, Table 5), while in the 250 normal populations Four specific mutations in the MSH6 gene were not found. It can be seen that the four specific mutations of MSH6 gene only exist in HR patients and their related family members, but not in normal people without HR.

[0050] Table 6 PCR primers and amplification conditions

[0051]

[0052] Example 4 Application of specific MSH6 mutant genes

[0053] like Figure 8 The family shown (family #7), both husband and wife are normal people, have given birth to a child with HR, and now plan to give birth again, and undergo fertility genetic counseling. Whole exome capture sequencing was performed on blood samples collected from both husband and wife and HR children. It was found that the g.[12907inCAGC] mutation of MSH6 gene was present in father I1 (heterozygote, genotype is Ad), and the mother I2 had g.[12907inCAGC] mutation in MSH6 gene. [12759inTTAAG] mutation (heterozygote, genotype is Ac), while HR child II1 has both g.[12759inTTAAG] mutation and g.[12907inCAGC] mutation (compound heterozygous mutation, genotype cd) of MSH6 gene, it can be seen that The two MSH6 gene mutations were inherited from his mother and father, respectively; except for these two specific mutations in MSH6 gene, no other obvious gene mutations were detected in the family members. The family conforms to the genotype-determining phenotype, and the phenotype achieves co-segregation with the genotype. Combined with the results of Examples 1-3, it can be seen that the MSH6 mutant gene is the pathogenic gene of HR, and it is autosomal recessive inheritance.

[0054] According to the law of gene segregation and free combination, it can be seen that the probability of the couple having another HR child is 1/4 (genotype cd), and the probability of having a carrier is 1/2 (genotype Ac or Ad, no HR phenotype) ), the probability of reproductive health is 1/4 (genotype is AA). Therefore, the couple decided to give birth again. The peripheral blood (10ml) of the mother's second child was collected at 14 weeks' gestation, and extracellular free DNA was extracted (kit from QIAgen, Germany). Referring to Example 1, whole exome capture and sequencing were used to detect the results. No mutations in the MSH6 gene were found (only the wild-type MSH6 gene was detected), so the pregnancy continued until a live birth, and a baby girl was eventually biopsied. The heel blood of the baby was collected, and the PCR capture and sequencing method (refer to Example 1) was used to detect the MSH6 gene mutation of the baby girl. As a result, no MSH6 gene mutation was detected. No HR symptoms were found during follow-up until about 2 years of age. It can be seen that MSH6 gene, as a newly revealed HR pathogenic gene, is of great significance for HR screening, diagnosis and fertility guidance of HR families.

[0055] To sum up, the MSH6 mutant genes with the four specific mutations of g.[7785-7788delGTGA], g.[7957inAA], g.[12759inTTAAG] and g.[12907inCAGC] disclosed by the present invention are all new to HR. Disease-causing genes, of which any homozygous mutation genotype or any compound heterozygous mutation genotype can lead to the occurrence of HR, and all are autosomal recessive; on this basis, PCR-based capture sequencing is provided. As well as two mutation detection kits based on conventional PCR and Sanger sequencing, these are of great significance for HR screening, diagnosis, and fertility guidance, especially helping to prevent the birth of HR children from the source. In addition, the disclosure of specific mutations in the MSH6 gene also contributes to the exploration of the pathogenesis of HR and the development of therapeutic drugs and methods.