Living cell marking method of biotinylated Curli protein and application of living cell marking method

A technology of biotinylation and biotin, applied in the field of genetic engineering, to achieve the effect of reducing potential impact, low biological toxicity and strong specificity

Pending Publication Date: 2021-04-06
JIANGSU UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant report on how to construct a live cell labeling method for biotinylated Curli protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Living cell marking method of biotinylated Curli protein and application of living cell marking method
  • Living cell marking method of biotinylated Curli protein and application of living cell marking method
  • Living cell marking method of biotinylated Curli protein and application of living cell marking method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of Escherichia coli expressing biotinylated Curli protein

[0032] (1) wxya It is the gene unit of extracellular amyloid Curli fiber, and it is expressed in Escherichia coli BL21(DE3) wxya The gene is the target gene, the peptide domain GLNDIFEAQKIEWHE is translated into a nucleotide sequence, and the flexible sequence GS and wxya The C-terminal fusion connection of the gene was constructed to express the gene fragment CsgA-APtag containing the biotin acceptor peptide; wxyaThe gene is used as a template, and Primer Premier 5.0 software is used to design amplification primers. There are two upstream primers, which are shown in SEQ ID NO.3, namely: TAGCAGCAATTGCAGCAAT, and SEQ ID NO.4, namely: TATTTGCTCTAGAATGAAACTTTTAAAAGTAGCAGCAATTGCAGCAAT; there are three downstream primers , as shown in SEQ ID NO.5, namely: CGACCGCTCATCAGTAC, as shown in SEQ ID NO.6, namely: CGACCGCTCATCAGTACGGCAGTGGCCTGAACGATATCTTTGAGGCACAAAAAATCGAGTGGCA and as shown in SEQ ...

Embodiment 2

[0039] Example 2: Verification of expression of biotinylated Curli protein in co-expressed BL21 (DE3) strain

[0040] In this example, four groups of different strains were used to verify the expression performance of biotinylated Curli protein, namely: Escherichia coli WM3064, wild Escherichia coli BL21 (DE3) strain, co-expression BL21 (DE3) strain and IPTG-induced co-expression Express BL21(DE3) strain; put Escherichia coli WM3064, wild Escherichia coli BL21(DE3) strain and two groups of single colonies co-expressing BL21(DE3) strain in 37℃ environment for 12-16h, respectively, at 1% ratio Transfer to fresh LB (containing 80uM biotin) medium; the medium of Escherichia coli WM3064 must be supplemented with Dap, and the medium of the co-expressing BL21 (DE3) strain must be supplemented with 40-50 μg / mL ampicillin resistance (Amp). Detection of strain OD by UV spectrophotometer 600 When the value is 0.4~0.6, randomly select a group of co-expressed BL21 (DE3) and add 0.4~0.6mM ...

Embodiment 3

[0044] Example 3: Fluorescent labeling of biotinylated Curli protein in co-expressed BL21 (DE3) strain

[0045] The wild BL21 (DE3) bacterial solution in Example 2 and the IPTG-induced co-expression BL21 (DE3) bacterial solution were mixed with FITC-coupled streptomycin at a volume ratio of 4-6:1, and incubated in the dark for 10 min. Take 1-3 μL of bacterial liquid and drop it on a glass slide, cover it with a cover glass, wash with PBS to remove excess avidin protein, and perform fluorescence microscopy imaging.

[0046] Figure 5 FITC-Avidin-labeled fluorescence imaging comparison chart; in the figure, the left picture is the strain imaging picture under bright field, and the right picture is the corresponding fluorescence imaging picture under 488nm. like Figure 5 It can be seen that the wild BL21(DE3) has no corresponding fluorescently labeled strain, indicating that the expressed Curli does not specifically bind to the fluorescent probe, and no biotinylated Curli is e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a living cell marking method of biotinylated Curli protein and application of the living cell marking method. The recombinant bacterium for expressing the biotinylated Curli protein is successfully constructed, escherichia coli BL21 (DE3) is used as a host strain, biotin receptor peptide (APtag) is fused into a gene structure unit csgA of escherichia coli BL21 (ED3) extracellular amyloid protein Curli, a co-expression plasmid pETDuet-1-CsgA-APtag-BirA is constructed, CsgA-APtag and biotin ligase BirA are highly expressed, and biotinylated expression of living cellCsgA is realized; under the induction of IPTG, the streptomycin probe coupled with the fluorophore can be specifically combined with biotinylated CsgA-APtag, and recombinant bacterial cells expressing Curli fibers can be subjected to fluorescence marking. The marking is high in specificity, and the potential influence of the marking on the cell expression function can be reduced to a certain extent.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a living cell labeling method of biotinylated Curli protein and an application thereof. Background technique [0002] In single-celled organisms such as bacteria, as the terminal for material exchange and reaction between cells and the environment, they have their own special biological functions. In order to better study the role and function of single-cell organisms such as bacteria in the environment, living cell labeling methods with lower biological toxicity and less impact on biological functions have been constantly pursued by scientists. Among the conventional labeling methods: antigen-antibody and gene fusion fluorescent protein (FPs) labeling methods have good biocompatibility, but there are problems of large secondary antibody size / large gene fusion fragment (~238aa), which changes the protein spatial structure of living cells and positioning, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/62C12N15/70C12P21/02C12R1/19
CPCC07K14/47C12N15/70C07K2319/32Y02A50/30
Inventor雍阳春周到方真
OwnerJIANGSU UNIV