A Recombinant Mutant Adeno-Associated Virus and Its Related Biomaterials Efficiently Infecting Primary Microglia
A technology of microglia and biomaterials, applied in viruses, viral peptides, microorganisms, etc., can solve problems such as limiting the application of AAV
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1. Construction of recombinant adeno-associated virus and analysis of its infection in primary microglial cells
[0046] 1. Packaging of recombinant adeno-associated virus (AAV)
[0047] 1. Preparation of recombinant plasmids (see figure 1 Middle A-D):
[0048] 1.1. Preparation of recombinant capsid packaging plasmid pAAV-6X
[0049] Using pAAV-RC6 as the original template, the sequence to be inserted (the underlined sequence in R) was designed on the downstream primer R, and the foreign sequence was inserted into the capsid sequence of pAAV-RC6 by PCR. Upstream primer F (nucleotide sequence is 5'-ACAGCAGCTACGCGCACA-3') and downstream primer R (nucleotide sequence is 5'-AGGCTCCCATAACATGCACATCTCCGGTCGCAGGGTCTGT CAGACGCGTCGGACCAACCGG GCTGCTGCTCTGGAGATTGAC-3′) 1 μl each (working solution concentration 10 μM), after 15 cycles, 1 μl Dpn1 enzyme was added to the PCR product to digest the original template plasmid pAAV-RC6. Afterwards, the PCR amplified product wa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


