Efficient electrotransfection method for HEK293F suspension cells
A technology of suspension cells and electrotransfection, which is applied in the field of transgenics, and can solve problems such as the need for electrotransfer buffers, the difficulty of cells reaching the threshold, and the large amount of nucleic acid used
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] 1. HEK293F electrotransfection method
[0024] 1.1pTT5-EGFP expression vector construction
[0025] The EGFP gene was cloned into the eukaryotic expression vector pTT5, and the EcoR I and Not I restriction sites were introduced at the 5' and 3' ends of EGFP through primer design, respectively, and the kozak sequence and initiation codon were introduced at the 5' end, A stop codon was introduced at the 3' end.
[0026] Primers were designed as follows:
[0027] F: 5'CCGGAATTCGCCACCATGCACCACCACCACCACATGGTGAGCAAGGGCGAGG3'
[0028] R: 5'TTGCGGCCGCTTACTTGTACAGCTCGTCCATG3'
[0029] Using pCDNA3.1-EGFP as a template, PCR was performed therewith using the above-mentioned primers. After electrophoresis of PCR products, gel recovery was performed to obtain EGFP fragments. The vector pTT5 and the target fragment EGFP were digested with two restriction enzymes EcoR I and Not I at 37°C for 30 min, and gel recovery was performed after electrophoresis to obtain the double digeste...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com