Check patentability & draft patents in minutes with Patsnap Eureka AI!

Efficient electrotransfection method for HEK293F suspension cells

A technology of suspension cells and electrotransfection, which is applied in the field of transgenics, and can solve problems such as the need for electrotransfer buffers, the difficulty of cells reaching the threshold, and the large amount of nucleic acid used

Pending Publication Date: 2021-05-21
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI +1
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Dendritic cells are the most powerful antigen-presenting cells found so far, and HepG2 cells are an important cell model for liver cancer research. Both are adherent cells and are the focus of tumor biotherapy; however, targeting dendritic cells and HepG2 When cells are electrotransfected, due to their high cell density, it is difficult for some cells to reach the threshold
Under the reported optimal electroporation conditions for DC cells and HepG2 cells, the electroporation efficiency is 50%-60%, but there are problems such as the need for electroporation buffer during electroporation, incubation at 4°C before electroporation, or large amount of nucleic acid.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient electrotransfection method for HEK293F suspension cells
  • Efficient electrotransfection method for HEK293F suspension cells
  • Efficient electrotransfection method for HEK293F suspension cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] 1. HEK293F electrotransfection method

[0024] 1.1pTT5-EGFP expression vector construction

[0025] The EGFP gene was cloned into the eukaryotic expression vector pTT5, and the EcoR I and Not I restriction sites were introduced at the 5' and 3' ends of EGFP through primer design, respectively, and the kozak sequence and initiation codon were introduced at the 5' end, A stop codon was introduced at the 3' end.

[0026] Primers were designed as follows:

[0027] F: 5'CCGGAATTCGCCACCATGCACCACCACCACCACATGGTGAGCAAGGGCGAGG3'

[0028] R: 5'TTGCGGCCGCTTACTTGTACAGCTCGTCCATG3'

[0029] Using pCDNA3.1-EGFP as a template, PCR was performed therewith using the above-mentioned primers. After electrophoresis of PCR products, gel recovery was performed to obtain EGFP fragments. The vector pTT5 and the target fragment EGFP were digested with two restriction enzymes EcoR I and Not I at 37°C for 30 min, and gel recovery was performed after electrophoresis to obtain the double digeste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an efficient electrotransfection method for HEK293F suspension cells. According to the method, the voltage intensity, the number of pulses, the pulse interval duration, the electric shock duration and the like during electrotransfection are optimized, so that efficient electrotransfection of the HEK293F cells subjected to suspension culture is achieved; and without preparing an electrotransfection buffer solution during electrotransfection, the relatively high transfection efficiency can be obtained. The method can be used for different plasmid transfected and suspension cultured HEK293F cells, and eukaryotic expression of a large number of target proteins (such as protein products of antibodies, enzymes and the like) is obtained.

Description

technical field [0001] The invention belongs to the field of transgenic technology, in particular to a high-efficiency electrotransfection method for HEK293F suspension cells. Background technique [0002] The liposome transfection method is currently the most used transfection method. Liposomes encapsulate DNA to form DNA / liposome complexes, and cells transfer DNA into cells by endocytosis. However, the quality of DNA has a great influence on the transfection efficiency. Small doses of endotoxin, salt ions, proteins and polysaccharides will affect the formation of complexes. Therefore, long-term contact of low-quality DNA with cells will lead to increased cell death. Reduced transfection efficiency. Moreover, the price of liposomes on the market is relatively high, which is not suitable for large-volume transfection. Although PEI is cheap, its transfection efficiency is low and its cytotoxicity is very high. Calcium phosphate transfection of cells requires large amounts ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N13/00
CPCC12N15/85C12N13/00
Inventor 金宗文卫小元罗擎颖赵江林刘宇光苏少博
Owner SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More