Single domain antibody, recombinant antibody, encoding gene and preparation method and application
A technology of recombinant antibody and single domain antibody, which is applied in the fields of genetic engineering and pest control, to achieve the effect of delayed evolution, small molecular weight and short production cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0036] In the present invention, the recombinant antibody is preferably prepared by prokaryotic expression. In the present invention, the specific preparation method preferably includes the following steps: cloning the gene encoding the recombinant antibody into an expression vector to obtain a recombinant vector, then transferring the recombinant vector into a host bacteria to obtain a recombinant strain, inducing the recombinant antibody The recombinant antibody is obtained by expressing the recombinant strain.
[0037] In the present invention, the expression vector is preferably pET-26b(+) vector; the host strain is preferably E.coliBL21(DE3). In the present invention, the steps of the synthesis of the gene encoding the recombinant antibody, the preparation of the recombinant vector, and the transformation of the recombinant vector into the host cell are preferably performed by a biological company. In the present invention, after the recombinant strain is obtained, seque...
Embodiment 1
[0043] The human single-domain antibody library in the form of TG1 host bacteria purchased from Source BioScience in the United Kingdom was rescued as a phage-displayed antibody library using the KM13 helper phage (for details, please refer to the literature (Selection of humanantibody fragments by phage display, NATURE PROTOCOLS|VOL.2NO. 11|200, doi: 10.1038 / nprot.2007.448); take the phage display library for targeted screening of the diamondback moth BBMV.
[0044] The preparation process of the diamondback moth BBMV is as follows: select the 4th instar larvae of the second day of the diamondback moth for dissection, wash the dissected midgut tissue with 0.15M sodium chloride and put it in an ep tube on ice. Good samples were placed in a -80°C refrigerator for later use. BBMV is obtained by the Mg-EGTA sedimentation method, and the specific operation steps are shown in the references: Wolfersberger M, Luethy P, Maurer A, et al. Preparation and partial characterization of ami...
Embodiment 2
[0050] Bispecific single chain antibody 4C1V H -2D3V L Prokaryotic expression of (recombinant antibody)
[0051] 2D3 is a monoclonal antibody that can broadly recognize Cry1A toxoid (see references: Construction, Expression, and Identification of Double Light Chain (V L -V L ) Antibody from a Unique Bt Cry1-Specific Monoclonal Antibody, Food Anal. Methods (2020) 13:1570–1582, https: / / doi.org / 10.1007 / s12161-020-01754-y), the light chain of 2D3 can be variable region V L The sequence and the sequence of 4C1 are connected by a 45bp linker, and a single-chain antibody 4C1V with a size of 786bp is obtained by splicing H -2D3V L . The nucleotide sequence of the linker is as follows: GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG (SEQ ID No. 7).
[0052] The corresponding amino acid sequence is as follows: GGGGSGGGGSGGGGS (SEQ ID No. 4).
[0053] single chain antibody 4C1V H -2D3V L的核苷酸测序结果如下:CAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGCGTCTCTCCTGTGCAGCCTCCGGATATAT...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com