Method for creating novel high-amylose rice germplasm and application of novel high-amylose rice germplasm

A high-amylose, new germplasm technology, applied in the field of gene editing, can solve problems such as incomplete clarity, and achieve the effect of low cost and high efficiency

Active Publication Date: 2021-06-18
CHINA NAT SEED GRP
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mechanism of regulation of OsWaxy gene expression is still not fully understood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for creating novel high-amylose rice germplasm and application of novel high-amylose rice germplasm
  • Method for creating novel high-amylose rice germplasm and application of novel high-amylose rice germplasm
  • Method for creating novel high-amylose rice germplasm and application of novel high-amylose rice germplasm

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1 Construction of CRISPR / Cas9 editing vector

[0077] Sequence analysis and gene editing target design of rice OsWaxy gene

[0078] The sequence of the rice OsWaxy gene is shown in SEQ ID NO:1. Sequence analysis showed that the gene contained 14 exons and 13 introns, of which the first intron was located in the 5'UTR, located at bases 139-1267 in SEQ ID NO:1. The target sequence 1 and target sequence 2 set in this example are both located in the first intron of the OsWaxy gene in the indica rice X32 and Kongyu 131 materials, wherein the target sequence 1 is at the 174-192 position of SEQ ID NO:1 base (i.e. TCTTATTCAGATCGATCAC (SEQ ID NO: 3)), the target sequence 2 is at the 1217-1236th base of SEQ ID NO.1 (GTTCAAATTCTTTTAGGCTC (SEQ ID NO: 4)), such as figure 2 .

[0079] Construction of CRISPR / Cas9 editing vector

[0080] The gene editing technology used in this example is the third generation gene editing technology CRISPR / cas9, the vector used is designed...

Embodiment 2

[0081] Example 2 Genetic transformation of indica rice X32 and japonica rice Kongyu 131

[0082] The editing vector constructed in Example 1 was transformed into Agrobacterium strain EHA105 (a gift from Huazhong Agricultural University) and sequenced for identification. Embryogenic calli were induced from the seeds of indica rice X32 and japonica rice Kongyu 131, respectively, and co-incubated with Agrobacterium EHA105 containing the above-mentioned editing vector, and genetic transformation was completed through a series of steps such as screening and regeneration. Agrobacterium-mediated transformation in rice. Nature protocols, 2006, 6:2 796-2802). The specific process includes, after 3 days of co-cultivation of the rice callus and Agrobacterium, the callus was added to the ddH of 250mg / L Carbenicillin 2 Soak in O for 30 minutes, remove excess Agrobacterium, and place on a screening medium containing 250 mg / L Carbenicillin for 3 rounds of screening, then transfer the resist...

Embodiment 3

[0083] Example 3 Screening and identification of T0 generation OsWaxy gene-edited rice

[0084]The regenerated strains in Example 2 were sent to the greenhouse for planting, and the leaves of the regenerated T0 generation seedlings were taken, and plant genomic DNA was extracted by the CTAB method as a template. DNA samples were positively detected by fluorescent quantitative PCR method. The fluorescent quantitative PCR method selects the screening marker gene CP4 as the target gene and the rice ACTIN1 gene as the internal reference gene, performs amplification and fluorescence value detection on a fluorescent quantitative PCR instrument, and screens out transgenic positive lines according to the RQ value (CP4 gene RQ value> 0.1, results not shown). The primer sequence used to amplify the screening marker gene CP4 is csp356: CAGCACAGGTTAAGTCTG (SEQ ID NO: 8) and csp357: GTCTGTCTCAACGGTAAG (SEQ ID NO: 9); the primer sequence used to amplify the ACTIN1 gene is csp106: TGCTATGTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for creating a novel rice high-amylose germplasm. The method comprises the step of modifying an OsWaxy gene in rice to enhance the transcriptional activity of the OsWaxy gene. The invention further discloses application of the rice created by the method to breeding or germplasm resource improvement, sgRNA capable of targeting the rice OsWaxy gene, and a CRISPR / Cas9 editing vector capable of targeting the rice OsWaxy gene. The homozygous non-transgenic rice edited by the OsWaxy gene obtained by the invention is a very valuable germplasm resource, and the amylose content of a rice variety can be improved by utilizing the OsWaxy gene. The invention also provides an effective strategy for rapidly improving the amylose content of a rice variety by utilizing a CRISPR / Cas9 gene editing technology.

Description

technical field [0001] The present application relates to the field of gene editing technology, in particular to a method for creating OsWaxy gene mutants to improve rice amylose content by using CRISPR / Cas9 gene editing technology. Background technique [0002] With the improvement of people's living standards, the consumption of rice has gradually turned to high quality and specialization. At present, it is recognized in the industry that the most important factor affecting the eating quality of rice is the amylose content, which is closely related to the hardness, cohesion and viscosity of rice texture. In terms of high quality, in the new standard NY / T 593-2013 edible rice quality grading index of the Ministry of Agriculture, the first-class rice of indica and japonica rice requires amylose content between 13% and 18%, and the content of amylose in the second-class rice of indica rice The requirement is between 13%-20%, while the third-grade rice is between 13%-22%. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/29A01H5/10A01H6/46
CPCC12N15/113C12N15/8218C12N15/8245C07K14/415C12N2310/20
Inventor丁琦刘行丹王文舒徐念魏晶吴晓李银龙马崇烈
OwnerCHINA NAT SEED GRP