Kit for detecting Hantaan-type hantavirus and detection method thereof
A hantavirus and detection method technology, applied in the field of medical biology, can solve the problems of only qualitative, low sensitivity, and quantitative detection, and achieve improved accuracy and variability, good sensitivity and accuracy, and high detection sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1, Hantavirus (Hantan type) primer design and specificity verification
[0052] (First, the purpose
[0053] The Hantaan-type primer set involved in the Hantavirus was designed, and its specificity was detected by dye method qPCR.
[0054] (2) Materials, reagents and instruments
[0055] 1. Main equipment
[0056] equipment name factory CFX96 TM Real-Time System
Bio-Rad
[0057] 2. Main reagents
[0058]
[0059] 3. Experimental materials (randomly select two RNA samples for testing)
[0060] name source Types of A260 A260 / A280 Concentration (ng / μL) YSFH-F-5 mouse lung tissue RNA 6.68 2.12 267.1 YSFHF28 mouse lung tissue RNA 5.17 2.23 206.71
[0061] 4. Primer Synthesis
[0062]
[0063] (3) Experimental process
[0064] 1. cDNA synthesis system and process
[0065]
[0066] 2. cDNA sample processing
[0067] The above 20 μL cDNA template was rehydrated to 100 μL, and ali...
Embodiment 2
[0092] The specificity verification of embodiment 2 Hantavirus (Hantan type) primers in negative samples
[0093] (First, the purpose
[0094] Validation of specificity of Hantan-type primers in negative samples.
[0095] (2) Materials, reagents and instruments:
[0096] 1. Main equipment
[0097] equipment name factory CFX96 TM Real-Time System
Bio-Rad
[0098] 2. Main reagents
[0099]
[0100] (3) Experimental process
[0101]
[0102]
[0103] (4) Test results
[0104] 1.Ct value
[0105] Primer name target fragment sample to be tested sample type Ct value Remark HAN-S-1F / R Hantan type S fragment HLD-F-10 Hantan type negative 37.78 not detected HAN-S-1F / R Hantan type S fragment YSFH-F-28 Hantan positive N / A not detected HAN-M-4F / R Hantan type M fragment YSFH-24 Hantan positive 31.14 check out HAN-M-4F / R Hantan type M fragment HLDF-10 Hantan type negative 37....
Embodiment 3
[0114] Example 3 Hantavirus (Hantan type) probe design and specificity verification-test positive and negative samples
[0115] (First, the purpose
[0116] The probes HAN-L-2p and HAN-M-4p were designed and synthesized, and the specificity of the primer-probe combination was verified by qPCR.
[0117] (2) Materials, reagents and instruments:
[0118] 1. Main equipment
[0119] equipment name factory CFX96 TM Real-Time System
Bio-Rad
[0120] 2. Main reagents
[0121] name Item No. factory PerfeCTa qPCR ToughMix UNG 95138 Quantabio
[0122] 3. Probe Synthesis
[0123] Primer / Probe Name sequence (5'-3') fluorescent label target gene HAN-L-2p AATTGCGACAGCCACATGGTT 5'FAM, 3'BHQ1 Hantan type L fragment HAN-M-4P CGGCTGCGGTATGATTCTTCCAC 5'HEX,3'BHQ1 Hantan type M fragment P_β-actin TACTCCTGCTTGCTGATCCACATC 5'CY5, 3'BHQ2 animal source
[0124] (3) Experimental process
[0...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com