Delivery vector for specific gene of neural stem cell and application of delivery vector
A technology of neural stem cells and delivery vectors, applied in the field of molecular pharmacology and molecular medicine, to achieve the effect of improving transduction efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] This embodiment provides the construction of AAV9 capsid protein gene random mutation library, comprising the following steps:
[0030] (1) Primer design
[0031] A total of 2 PCR primers were designed to mutate the AAV9 capsid, namely:
[0032] Primer F (TCAGGTGTTTACTGACTCGGAG, SED ID NO: 2);
[0033] Primer R (CGTCACACATACGACACCGG, SED ID NO: 3).
[0034] (2) Error-prone PCR
[0035] Using the plasmid pAAV9 as a template and primers F and R as paired primers, the random mutation library of AAV9 capsid protein was prepared by repeated error-prone PCR. The plasmid pAAV9 used in this example is a plasmid carrying the whole gene of the wild-type AAV9 virus, which was constructed by Huaqiao University School of Medicine. Among them, the Cap gene is responsible for encoding the capsid protein of the AAV9 virus.
[0036] The ready-to-use error-prone PCR kit produced by Beijing Tianenze Gene Technology Co., Ltd. was used for preparation.
[0037] As shown in Table 1, ad...
Embodiment 2
[0047] The preparation of AAV9 capsid mutant library is provided in this embodiment, comprising the following steps:
[0048] 293 cells were inoculated in culture dishes and cultured overnight in DMEM medium containing 10% FBS until the confluence was about 80%.
[0049] Take 1 mL serum-free medium, add 8 μg pAAV9-lib and 10 μg helper plasmid pFd6, mix gently, then add 1 mg / mL PEI solution at a ratio of 1:3, and vortex to mix. Add dropwise evenly to the culture medium of 293 cells, and at the same time shake gently to mix as soon as possible.
[0050] Place cells at 37 °C, 5% CO 2 16 hours after transfection, the old medium was discarded, and 10 mL of fresh DMEM medium containing 10% FBS was added.
[0051] Continue culturing in the cell incubator for 72 hours, collect the cells into a 15mL centrifuge tube, centrifuge at 1000g, 4°C for 15min, store the supernatant at 4°C, and resuspend the pellet with 1mL PBS solution into a 1.5mL centrifuge tube.
[0052] The collected cel...
Embodiment 3
[0055] This embodiment provides the preparation of human neural stem cells, comprising the following steps:
[0056] In strict accordance with the general procedures and standards of clinical neurosurgery, the cerebral cortex tissue of aborted fetuses (3 months old) was obtained through minimally invasive surgery. Put the flat plate of the brain under a dissecting microscope, use a scalpel to make a coronal incision behind the olfactory bulb, and then use fine forceps to remove the remaining choroid plexus in the ventricle. Next, using finely curved micro-scissors, cut the thin layer of tissue around the ventricle, excluding the striatal parenchyma and corpus callosum, and place the dissected tissue into a 6-well cell plate containing sterile PBS.
[0057] Place the 6-well cell plate under a tissue culture laminar flow hood, add 5ml of papain solution to each well, and incubate in a cell culture incubator at 37°C for 30min. Using a P1000 pipette, transfer the contents of each...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



