Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Delivery vector for specific gene of neural stem cell and application of delivery vector

A technology of neural stem cells and delivery vectors, applied in the field of molecular pharmacology and molecular medicine, to achieve the effect of improving transduction efficiency

Active Publication Date: 2021-06-25
HUAQIAO UNIVERSITY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, direct gene delivery to the SVZ remains challenging, and there is currently no gene therapy vector capable of targeting and transducing NSCs within the SVZ microenvironment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Delivery vector for specific gene of neural stem cell and application of delivery vector
  • Delivery vector for specific gene of neural stem cell and application of delivery vector
  • Delivery vector for specific gene of neural stem cell and application of delivery vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] This embodiment provides the construction of AAV9 capsid protein gene random mutation library, comprising the following steps:

[0030] (1) Primer design

[0031] A total of 2 PCR primers were designed to mutate the AAV9 capsid, namely:

[0032] Primer F (TCAGGTGTTTACTGACTCGGAG, SED ID NO: 2);

[0033] Primer R (CGTCACACATACGACACCGG, SED ID NO: 3).

[0034] (2) Error-prone PCR

[0035] Using the plasmid pAAV9 as a template and primers F and R as paired primers, the random mutation library of AAV9 capsid protein was prepared by repeated error-prone PCR. The plasmid pAAV9 used in this example is a plasmid carrying the whole gene of the wild-type AAV9 virus, which was constructed by Huaqiao University School of Medicine. Among them, the Cap gene is responsible for encoding the capsid protein of the AAV9 virus.

[0036] The ready-to-use error-prone PCR kit produced by Beijing Tianenze Gene Technology Co., Ltd. was used for preparation.

[0037] As shown in Table 1, ad...

Embodiment 2

[0047] The preparation of AAV9 capsid mutant library is provided in this embodiment, comprising the following steps:

[0048] 293 cells were inoculated in culture dishes and cultured overnight in DMEM medium containing 10% FBS until the confluence was about 80%.

[0049] Take 1 mL serum-free medium, add 8 μg pAAV9-lib and 10 μg helper plasmid pFd6, mix gently, then add 1 mg / mL PEI solution at a ratio of 1:3, and vortex to mix. Add dropwise evenly to the culture medium of 293 cells, and at the same time shake gently to mix as soon as possible.

[0050] Place cells at 37 °C, 5% CO 2 16 hours after transfection, the old medium was discarded, and 10 mL of fresh DMEM medium containing 10% FBS was added.

[0051] Continue culturing in the cell incubator for 72 hours, collect the cells into a 15mL centrifuge tube, centrifuge at 1000g, 4°C for 15min, store the supernatant at 4°C, and resuspend the pellet with 1mL PBS solution into a 1.5mL centrifuge tube.

[0052] The collected cel...

Embodiment 3

[0055] This embodiment provides the preparation of human neural stem cells, comprising the following steps:

[0056] In strict accordance with the general procedures and standards of clinical neurosurgery, the cerebral cortex tissue of aborted fetuses (3 months old) was obtained through minimally invasive surgery. Put the flat plate of the brain under a dissecting microscope, use a scalpel to make a coronal incision behind the olfactory bulb, and then use fine forceps to remove the remaining choroid plexus in the ventricle. Next, using finely curved micro-scissors, cut the thin layer of tissue around the ventricle, excluding the striatal parenchyma and corpus callosum, and place the dissected tissue into a 6-well cell plate containing sterile PBS.

[0057] Place the 6-well cell plate under a tissue culture laminar flow hood, add 5ml of papain solution to each well, and incubate in a cell culture incubator at 37°C for 30min. Using a P1000 pipette, transfer the contents of each...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a neural stem cell specific gene delivery carrier and application thereof, and relates to the technical field of molecular pharmacology and molecular medicine. The delivery vector is a novel rAAV vector obtained by carrying out random gene mutation on the basis of a recombinant adeno-associated virus 9 and carrying out multiple rounds of in-vitro screening by taking neural stem cell spheres as a model. The amino acid sequence of the capsid protein of the delivery carrier is shown as SED ID NO: 1, the delivery carrier can efficiently deliver transgenic elements to neural stem cells in a targeted mode, compared with an rAAV9 carrier commonly used for transduction of a nervous system, the delivery carrier has the advantages that the transduction efficiency of the neural stem cells is remarkably improved, and the delivery carrier can be used for preparing drugs for diseases related to the nervous system.

Description

technical field [0001] The invention relates to the technical field of molecular pharmacy and molecular medicine, and in particular to a neural stem cell-specific gene delivery carrier and application thereof. Background technique [0002] Neural stem cells (NSCs) are a class of pluripotent cells capable of self-renewal and differentiation into different neural cell types. Under certain conditions, it can differentiate into different functional cells, including neurons, astrocytes, and oligodendrocytes. Although the level of neuronal neogenesis is low in healthy adults, it has been found to exist in disease states such as stroke, epilepsy and Huntington's disease. The findings suggest the possibility of potentially providing therapeutic intervention by inducing new neuronal regeneration in humans. Using this as a basis to replace or repair those damaged nerve tissues or organs is expected to provide a cure for neurological diseases for which there is currently no cure. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/864C07K14/015A61K48/00A61P9/10A61P25/08A61P25/14
CPCC12N15/86C07K14/005A61K48/0008A61P9/10A61P25/08A61P25/14C12N2750/14143C12N2750/14122C12N2800/107
Inventor 刁勇盛晓菁
Owner HUAQIAO UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com