Supercharge Your Innovation With Domain-Expert AI Agents!

Application of Lgr5 gene in protection of inner ear hair cells and promotion of support cell regeneration

A technology of inner ear hair cells and supporting cells, applied in epidermal cells/skin cells, applications, animal cells, etc., can solve the problems of low regeneration efficiency and unclear molecular mechanism.

Pending Publication Date: 2021-07-23
SOUTHEAST UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although hearing aids and cochlear implants can help patients rebuild their auditory function, they all rely on the remaining hair cells, which have certain limitations and cannot fundamentally solve the problem
[0003] The existing technology can only regenerate some supporting cells into hair cells, and the regeneration efficiency is not particularly high, and the molecular mechanism involved in this process is still not very clear. This may be the result of the interaction of multiple genes and multiple signaling pathways, and subsequent exploration is needed to illustrate this complex regeneration process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Lgr5 gene in protection of inner ear hair cells and promotion of support cell regeneration
  • Application of Lgr5 gene in protection of inner ear hair cells and promotion of support cell regeneration
  • Application of Lgr5 gene in protection of inner ear hair cells and promotion of support cell regeneration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The adenoviruses of Lgr5, Lgr5-C, Lgr5-190 and RFP (control) used in the present invention were all directly purchased from Hanbio, and all viruses had red fluorescence.

[0034] Among them, the nucleotide sequence information of Lgr5, Lgr5-C and Lgr5-190 are described in SEQ NO.1, SEQ NO.2 and SEQ NO.3 respectively.

[0035] SEQ NO.1:

[0036] ATGGACACCTCCTGCGTCCACATGCTCCTGTCCTTGCTGGCGCTGCTGCAGTTGGTGGC CGCCGGCAGCTCACCGGGACCAGATGCGATACCGCGGGGCTGCCCATCACACTGTCAC TGTGAGCTGGATGGCAGGATGCTGCTCAGGGTGGACTGCTCGGACCTGGGGCTCTCGG AGCTGCCCTCCAACCTCAGCGTCTTCACCTCCTACCTGGACCTCAGTATGAACAACATC AGTCAGCTACCCGCCAGTCTCCTACATCGCCTCTGCTTCCTAGAAGAGTTACGTCTTGCTGGAAATGCTTTGACACACATTCCCAAGGGAGCGTTCACGGGCCTTCACAGCCTCAAA GTGCTTATGCTGCAGAACAACCAGCTGAGACAGGTTCCGGAGGAAGCGCTACAGAAT TTGAGAAGCCTTCAATCCCTGCGCCTAGATGCCAACCACATCAGCTACGTGCCACCCA GCTGTTTCAGCGGCCTGCACTCCCTGAGGCACCTGTGGCTAGATGACAATGCTCTCAC AGACGTCCCTGTCCAGGCTTTCAGAAGTTTATCAGCCCTGCAAGCCATGACCTTGGCC CTGAACAAAATACACCACATAGCAGACTACGCCTTTGGAAACCTCTC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an Lgr5 gene in protection of inner ear hair cells and promotion of support cell regeneration. The C end of the Lgr5 has a nucleotide sequence as shown in SEQ NO.1, and the 190th site of the N end of the Lgr5 has a nucleotide sequence for coding alanine. Firstly, adenoviruses of Lgr5, Lgr5-C (the part after the 823 amino acid on the Lgr5 is completely cut off) and Lgr5-190 (the 190 amino acid on the Lgr5 is changed from alanine to aspartic acid) are constructed; the protection effect of the C tail end and the N tail end of the Lgr5 gene on hair cells and the regeneration effect of inner ear stem cells are researched respectively; and finally the action mechanisms of the C tail end and the N tail end of the Lgr5 gene in an inner ear are researched respectively. Therefore, the action mechanism that the Lgr5 gene protects the hair cells and regenerates supports cells into the hair cells is determined; a new theoretical thought is provided for deafness treatment; and the Lgr5 gene replaces hearing aids and artificial cochlea to help a patient recover and rebuild the auditory function.

Description

technical field [0001] The invention relates to the technical field of protection and regeneration of cochlear hair cells, in particular to the application of Lgr5 gene in protecting inner ear hair cells and promoting the regeneration of supporting cells. Background technique [0002] In mammals, auditory hair cells and supporting cells are only produced during embryonic development. The loss of hair cells due to environmental stress, ototoxicity, genetic factors or aging is permanent. Once damaged, it will cause permanent deafness. The inner ear hair The irreversible damage of cells is the core cause of sensorineural deafness. Although hearing aids and cochlear implants commonly used in clinical practice can improve the patient's hearing to a certain extent, their effects are completely dependent on the quantity and quality of residual hair cells; therefore, the most ideal way to treat sensorineural hearing loss is through Stem cell therapy regenerates hair cells to restor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/861C12N5/10G01N33/569
CPCC07K14/47C12N15/86C12N5/0627G01N33/56966C12N2710/10043C12N2510/00
Inventor 柴人杰张李燕高下唐明亮张莎莎
Owner SOUTHEAST UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More