A kind of aminoglycoside antibiotic resistance gene detection primer and kit
A technology for aminoglycosides and antibiotic resistance, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc. It can solve the problems of small throughput, heavy workload of calculating absolute copy number, high false positive, etc. problem, to achieve the effect of large detection throughput, rapid detection and guaranteed accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] This example provides high-throughput quantitative detection primers for aminoglycoside antibiotic resistance genes. The high-throughput quantitative detection primer pairs for aminoglycoside antibiotic resistance genes are artificially synthesized and composed of 35 aminoglycoside antibiotic resistance genes. The sequence composition of primer pair and 16S rRNA gene standard is as follows:
[0087]
[0088]
[0089] The 16S rRNA gene standard sequence is as follows:
[0090]GCCCGTGACCTCGTCGTATTGACTGCATCGCGTGTCGCCCTTGATCCTAAACATAACCACTAACTGCAATATCTTATTATCATCATGTTCCACAGCTCCTCAGGCTTTATTCATGTCCATTCTTCATCAAATTCGTCATTTTTCACCAAAATGCATTGTGATAAACGATTATCACTTAAGATAATCGATTGTCTTAGTGAAATTTAACCAGAAACATCATGCAGGATGTGATAATTGAATATCAACCCAGATAATCAATTATTCCTAAAACCATTTTCAAAACCTACATGCAACTAATCAAAGGGCGACACGCGATTGCAGCGAGCCTCAGACACTGGCCGTCGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCGCTCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGGTAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACC...
Embodiment 2
[0092] Based on the primer pairs obtained in Example 1, this example provides a kit, including the following contents:
[0093] A high-throughput quantitative detection kit for aminoglycoside antibiotic resistance genes in the environment, including 35 pairs of aminoglycoside antibiotic resistance genes and specific primers for the internal reference 16S rRNA gene, qPCR reaction reagents, smartchip chips and wafergen consumables.
[0094] Among them, the wafergen consumables include 384 deep-well plate, qPCR membrane, chip temporary sealing membrane, chip filter membrane and chip qPCR membrane.
[0095] The qPCR reaction reagents included 2×LightCycler 480SYBR Green IMaster, ROX, Oligo(F+R), 5 different serial dilutions of DNA standard plasmid and NF H 2 0.
Embodiment 3
[0097] A high-throughput quantitative detection method for aminoglycoside antibiotic resistance genes in the environment, which specifically includes the following steps:
[0098] 1: Standard curve drawing
[0099] Construction of 16S rRNA positive control
[0100] The first step: use 16S rRNA-specific primers to screen a large number of environmental samples, and the screening is to amplify the environmental samples by qPCR, and the environmental samples are nucleic acid samples;
[0101] Step 2: Observe the amplification curve and dissolution curve of qPCR, the dissolution curve has a single peak, the CT value of the amplification curve is less than 25, and the sample of this reaction is determined as a candidate sample corresponding to the specific primer;
[0102] Step 3: Amplify the corresponding candidate samples by PCR with 16S rRNA-specific primers;
[0103] Step 4: The PCR product is subjected to agarose electrophoresis, gel cutting recovery, and first-generation se...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



