Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aminoglycoside antibiotic resistance gene detection primer and kit

An aminoglycoside, antibiotic resistance technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. and other problems, to achieve the effect of large detection throughput, ensure accuracy, and achieve rapid detection

Active Publication Date: 2021-07-23
ANHUI NORMAL UNIV +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Aiming at the problems of low throughput of qPCR method in the prior art, high false positives, heavy workload for calculating absolute copy number, etc., the present invention provides primers and kits for high-throughput quantitative detection of aminoglycoside antibiotic resistance genes in the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aminoglycoside antibiotic resistance gene detection primer and kit
  • Aminoglycoside antibiotic resistance gene detection primer and kit
  • Aminoglycoside antibiotic resistance gene detection primer and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] This embodiment provides high-throughput quantitative detection primers for aminoglycoside antibiotic resistance genes. The high-throughput quantitative detection primer pairs for aminoglycoside antibiotic resistance genes are artificially synthesized, consisting of 35 aminoglycoside antibiotic resistance genes. The primer pair and 16S rRNA gene standard sequence composition are as follows:

[0087]

[0088]

[0089] The 16S rRNA gene standard product sequence is as follows:

[0090]GCCCGTGACCTCGTCGTATTGACTGCATCGCGTGTCGCCCTTGATCCTAAACATAACCACTAACTGCAATATCTTATTATCATCATGTTCCACAGCTCCTCAGGCTTTATTCATGTCCATTCTTCATCAAATTCGTCATTTTTCACCAAAATGCATTGTGATAAACGATTATCACTTAAGATAATCGATTGTCTTAGTGAAATTTAACCAGAAACATCATGCAGGATGTGATAATTGAATATCAACCCAGATAATCAATTATTCCTAAAACCATTTTCAAAACCTACATGCAACTAATCAAAGGGCGACACGCGATTGCAGCGAGCCTCAGACACTGGCCGTCGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCGCTCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGGTAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCA...

Embodiment 2

[0092] Based on the primer pair obtained in Example 1, this example provides a kit, including the following:

[0093] A high-throughput quantitative detection kit for aminoglycoside antibiotic resistance genes in the environment, including specific primers for 35 pairs of aminoglycoside antibiotic resistance genes and internal reference 16S rRNA genes, qPCR reaction reagents, smartchip chips, and wafergen consumables.

[0094] Wherein, the wafergen consumables include 384 deep-well plates, qPCR membranes, chip temporary sealing membranes, chip filter membranes and chip qPCR membranes.

[0095] The qPCR reaction reagents include 2×LightCycler 480SYBR Green IMaster, ROX, Oligo (F+R), 5 different serially diluted DNA standard plasmids and NF H 2 0.

Embodiment 3

[0097] A high-throughput quantitative detection method for aminoglycoside antibiotic resistance genes in the environment, specifically comprising the following steps:

[0098] 1: Standard curve drawing

[0099] 16S rRNA positive control substance construction

[0100] The first step: use 16S rRNA-specific primers to screen a large number of environmental samples, the screening is to amplify the environmental samples by qPCR, and the type of environmental samples is nucleic acid samples;

[0101] Step 2: Observe the amplification curve and melting curve of qPCR, the melting curve has a single peak, and the CT value of the amplification curve is less than 25, and determine that the sample of this reaction is a candidate sample corresponding to the specific primer;

[0102] Step 3: use 16S rRNA-specific primers to PCR amplify the corresponding candidate samples;

[0103] Step 4: The PCR product is subjected to agarose electrophoresis, gel cutting and recovery, and first-generat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of kits, and provides a high-throughput quantitative detection primer and kit for aminoglycoside antibiotic resistance genes in the environment. The high-throughput quantitative detection primer comprises a primer, a qPCR reaction reagent, a smartchip chip and a wafergen consumable; the primer is composed of 35 pairs of specific primers of aminoglycoside antibiotic resistance genes and internal reference 16SrRNA genes; the wafergen consumable comprises a 384 deep hole plate, a qPCR (quantitative polymerase chain reaction) membrane, a chip temporary sealing membrane, a chip filter membrane and a chip qPCR membrane; and the kit can be used for detecting 144 environmental samples at one time. A wafergen platform is adopted for ARGs detection, and the defect that an existing qPCR method is low in flux is well overcome. Through a self-compiled automatic script, rapid calculation of the absolute copy number is realized. The 36 pairs of primers are pre-sprayed on a chip and then assembled into the kit, so that the rapid detection of subsequent environmental detection points is facilitated.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a high-throughput quantitative detection primer and a kit for aminoglycoside antibiotic resistance genes in the environment. Background technique [0002] Since the discovery of antibiotics, the widespread application in clinical medicine, animal husbandry, and agricultural pest control has led to the spread of drug-resistant pathogens and resistance genes, and its harm has attracted worldwide attention. In 2014, the World Health Organization (WHO) report pointed out that antibiotic resistance is the most serious human health challenge in the 21st century, and global supervision of drug resistance needs to be strengthened. Studies have long proposed resistance genes as a new environmental pollutant. [0003] Aminoglycoside antibiotics are spectrum and high-efficiency antibiotics with many characteristics suitable for clinical treatment of infections, especially for the t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/686C12N15/11
CPCC12Q1/689C12Q1/686C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 高轩张鸿李西清唐聪王丽达张慧
Owner ANHUI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com