Unlock instant, AI-driven research and patent intelligence for your innovation.

Genetic engineering strain, preparation thereof and directed evolution method for antibody affinity maturation based on genetic engineering strain

A technique of genetically engineered strains and directed evolution, applied in the field of directed evolution of antibody affinity maturation

Inactive Publication Date: 2021-07-27
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0016] Therefore, although the continuous evolution system in vivo has developed rapidly, and antibody affinity improvement methods also exist, there is no continuous evolution method for antibody affinity maturation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain, preparation thereof and directed evolution method for antibody affinity maturation based on genetic engineering strain
  • Genetic engineering strain, preparation thereof and directed evolution method for antibody affinity maturation based on genetic engineering strain
  • Genetic engineering strain, preparation thereof and directed evolution method for antibody affinity maturation based on genetic engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Example 1 Establishment of Mutation and Screening System Integration and Feasibility Exploration

[0083] 1. Plasmid construction of mutation screening system integration (using GCN4 / GCN4 3mut as an example to explore the feasibility)

[0084] 1.1 GCN4 3mut Identification of mutation sites. The literature shows that GCN4 is a yeast transcription factor, and GCN4-"Leucine-Zipper" can form a dimer. We selected this region for verification experiments, and it is still referred to as GCN4 below. Previous studies have found that mutations at L12E, N16A, and L19A of GCN4 can greatly reduce the formation of GCN4 homodimer, such as Figure 4 shown. After rational design, it was determined that the GCN4 wild type ( Figure 4 , Figure 5 GCN4 in WT ) and mutant ( Figure 4 , Figure 5 GCN4 in 3mut ) protein sequence is as follows.

[0085] GCN4 wild type: LEDKVEELLSKNYHLENEVARLKKLVGER (formerly SEQ ID NO: UniProtKB-P03069, SEQ ID NO.5)

[0086] GCN4 3mut Mutant: LEDK...

Embodiment 2

[0117] Example 2 The backbone plasmid optimization of the integration of mutation and screening system

[0118] 1. Construction of backbone plasmids pEP-mcs-(GGGGS)2-F1,2-Flag, pWT-mcs-(GGGGS)2-F1,2-Flag and pLA230-mcs-(GGGGS)2-F3-6xHis

[0119] 1.1 Thya is constructed into the mutant plasmid. According to the principle of plasmid construction in Example 1, the upstream and downstream primers F1-thya and R1-thya were designed, and the gene sequence expressing thyA was inserted into the NdeI restriction site of the mutant plasmid pEP and the control plasmid pWT described in the above Example 1 , namely pEP-thya and pWT-thya plasmids.

[0120] Upstream primer F1-thya: AAAGGGAAAACTGTCCATATGCGCGGATCATATACA (SEQ ID NO.18)

[0121] Downstream primer R1-thya: CCGTTTTCATCTGTGCATATGTTAGTGGTGGTGGTG (SEQ ID NO.19)

[0122] 1.2 Cloning of target fragments. The upstream and downstream primers F1-pEP(pWT)-2 and R1-pEP(pWT)-2, as well as F1-pLA230-2 and R1-pLA230-2 were designed accordin...

Embodiment 318A4

[0135] Example 3 18A4Hu antibody affinity maturation

[0136] 1.18A4Hu mutant plasmid, target plasmid and strain construction

[0137] Design upstream and downstream primers according to the principle of homologous recombinase construction plasmid, and PCR obtains the target fragments SEQ-AGR2 (sequence shown in SEQ ID NO.21) and SEQ-18A4Hu scFv (sequence shown in SEQ ID NO.22), insert the target fragment into the backbone plasmid pEP-mcs-(GGGGS)2-F1,2-Flag and pLA230-mcs-(GGGGS)2 constructed in Example 2 respectively - In F3-6xHis, the restriction sites are BamHI / NotI and MfeI / NcoI, respectively, to obtain plasmids pEP-AGR2-(GGGGS)2-F1,2-Flag (sequence shown in SEQ ID NO.23) and pLA230- 18A4Hu scFv -(GGGGS)2-F3-6xHis (sequence shown in SEQ ID NO. 24). Then plasmid pEP-AGR2-(GGGGS)2-F1,2-Flag and pLA230-18A4Hu scFv - (GGGGS)2-F3-6xHis was constructed into the JS200-ΔthyaΔfola strain obtained in Example 1 to obtain an engineering strain of Escherichia coli containing these ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of continuous directed evolution, in particular to a genetic engineering strain, preparation thereof and a continuous directed evolution method for antibody affinity maturation based on the strain. The bacterial strain is obtained by constructing a mutant plasmid and a screening target plasmid into a modified bacterial strain JS200-delta thya delta fola; the mutant plasmid comprises pEP-mcs-(GGGGS) < 2 >-F1, 2-Flag, and the screening target plasmid comprises pLA230-mcs-(GGGGS)2-F3-6xHis. The antigen and the antibody are respectively fused with two functional complementary fragments F1,2 and F3 of mDHFR (murine DHFR), so that Ag-F1, 2 and Ab-F3 are formed. Through stepwise increasing trimethoprim (TMP) resistance screening, the method can be realized in a solid / liquid space, an antibody monoclonal strain with improved affinity is obtained through solid / liquid culture, the operation is simple, and the flux is high.

Description

technical field [0001] The invention relates to the technical field of directed evolution, in particular to a genetically engineered strain, its preparation and a directed evolution method for antibody affinity maturation based on the strain. Background technique [0002] Antibody affinity maturation is a process of improving antibody affinity, activity, and antigen binding ability. Antibody affinity maturation in the natural process is achieved by repeated antigen stimulation and selection of B cell immunoglobulin genes under the conditions of VDJ rearrangement and somatic cell overfrequency mutation. However, high-affinity antibodies have great application value in dealing with the first infection and post-infection treatment. In 2005, Song et al. reported antibody-mediated targeted gene therapy in vivo for the first time. Antibody fragments were mixed with siRNA (c-myc, MDM2, VEGF) to form complexes, targeting cells in vivo containing corresponding antigens, and effectiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/66C12N15/65C12N15/54C12N15/13C12N15/10C12R1/19
CPCC12N9/1252C12N9/1007C12N15/70C12N15/65C12N15/1024C07K16/00C12Y207/07007C12Y201/01045C07K2317/92
Inventor 陶生策张海南薛俊彪
Owner SHANGHAI JIAO TONG UNIV