Nano-antibody for resisting B cell maturation antigen and application of nano-antibody

A nanobody and B cell technology, applied in the direction of anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, receptor/cell surface antigen/cell surface determinant, medical preparations containing active ingredients, etc. It can solve problems such as obvious side effects and insufficient clinical data, and achieve the effect of improving lethality

Active Publication Date: 2021-08-17
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Allogeneic hematopoietic stem cell transplantation can eliminate myeloma cells, but this therapy has significant side effects and only a small number of people benefit
In addition, nanobodies have also shown some potential in the treatment of myeloma, but there is not yet enough clinical data to confirm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nano-antibody for resisting B cell maturation antigen and application of nano-antibody
  • Nano-antibody for resisting B cell maturation antigen and application of nano-antibody
  • Nano-antibody for resisting B cell maturation antigen and application of nano-antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] This example is used for the construction and panning of the phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0064] (1) Construction of phage nanobody library

[0065] Bactrian camels were immunized with BCMA-Fc expressing the extracellular region, and after the titer was verified by ELISA, 200 mL of peripheral blood was extracted; lymphocytes were sorted, and peripheral blood mononuclear lymphocyte precipitates were obtained, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; inserts the VHH gene into the pMECS phage display vector, electrotransforms TG1 competent cells, and takes an appropriate amount of bacterial liquid for library identification , and all the remaining cultures were evenly spread on LB / AMPGLU plates. After the bacteria grew out, the bacterial lawn was collected, and 1 / 3 volume of 50% glyc...

Embodiment 2

[0079] In this example, the candidate clones were screened using the flow cytometry fluorescence sorting technique (Fluorescence activated Cell Sorting, FACS).

[0080] Carry out cell culture according to the standard cell culture protocol, use trypsin to digest cells to prepare BCMA-positive and negative cell suspensions; 6 cell / mL; Add 2×10 to each well in a V-bottom 96-well plate 5 After centrifuging at 300g for 5min, remove the supernatant, add VHH antibody crude extract to resuspend the cells, and incubate at 4°C for 1h;

[0081] After centrifuging at 300g for 5 minutes, remove the supernatant, resuspend the cells in Flow Buffer, use Flow Buffer to dilute the APCanti-his antibody to 2 μg / mL, resuspend the cells in 100 μL per well, and incubate at 4 °C for 1 hour; wash the cells 3 times with Flow Buffer and then use 200 μL Flow Buffer Cells were resuspended and analyzed by flow cytometry.

Embodiment 3

[0083] In this example, the VHH-mIgG2a Fc nanobody was expressed and purified, and the antibody affinity was measured. In order to further identify the screened antibodies, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was first constructed, which was denoted as C-4 pCP.Stuffer-mCg2a-FC, and the specific steps were as follows:

[0084] 1. Using PCR to amplify BCMA VHH B12, the primers are:

[0085] HDB12-F (SEQ ID NO. 10):

[0086] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTGCAGCTGGTGGA;

[0087] HD-B12-R (SEQ ID NO.11):

[0088] GCATGGAGGACAGGGCTTGATTGTGGGGCTGCTCACGGTCACCTG

[0089] The reaction system is shown in Table 2, and the amplification program is shown in Table 3 below:

[0090] Table 2

[0091]

[0092] table 3

[0093]

[0094] 2. The enzyme digestion system is shown in Table 4. The enzyme digestion temperature is 37°C and the time is 6 hours. The PCR purification kit was used for purificati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nano-antibody for resisting a B cell maturation antigen and application of the nano-antibody. The nano-antibody for resisting the B cell maturation antigen is BCMA-12, and a heavy chain variable region of the BCMA-12 comprises a complementary determining region 1 as shown in SEQ ID NO. 1, a complementary determining region 2 as shown in SEQ ID NO. 2 and a complementary determining region 3 as shown in SEQ ID NO. 3. The nano-antibody screened by using a phage display nano-antibody library has a specific CDR region, and the obtained nano-antibody can specifically bind to a BCMA antigen and has good affinity; when being used as an antigen binding structural domain to construct a chimeric antigen receptor and a CAR-T cell, the nano-antibody has obvious killing activity on BCMA-positive tumor cells; and therefore, the nano-antibody has wide application prospects in the aspect of immunotherapy of multiple myeloma.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a nanobody against B cell mature antigen and its application. Background technique [0002] Through genetic engineering technology, T cells are activated and carry tumor chimeric antigen receptor (CAR) to obtain chimeric antigen receptor modified T lymphocytes (Chimeric antigen receptor T cells, CAR-T), CAR-T cells specifically recognize In vivo tumor cells, and through the release of a variety of effectors through immune function, effectively kill tumor cells, so as to achieve the purpose of treating malignant tumors. From the development of CAR-T cells to the present, scientists have continued to try and optimize them. In recent years, CAR-T therapy has developed rapidly. Among them, CD19 (B lymphocyte antigen CD19, CD19)-targeted CAR-T cells are used for relapse / Clinical research on refractory chronic B lymphocytic leukemia, and achieved amazing curative effe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/28C07K19/00C12N15/13C12N15/867C12N7/01C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C12N15/86A61K39/0011A61P35/00C07K2317/22C07K2317/565C07K2317/567C07K2317/569C07K2317/92C07K2319/02C07K2319/03C07K2319/33C12N2740/15021C12N2740/15043
Inventor狄升蒙童东阳茅健
OwnerHUADAO SHANGHAI BIOPHARMA CO LTD