Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of nanobody against B cell maturation antigen and its application

A nanobody, B cell technology, applied in the direction of anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, receptor/cell surface antigen/cell surface determinant, medical preparations containing active ingredients, etc. It can solve the problems of obvious side effects and insufficient clinical data, and achieve the effect of improving the killing ability.

Active Publication Date: 2022-07-29
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Allogeneic hematopoietic stem cell transplantation can eliminate myeloma cells, but this therapy has significant side effects and only a small number of people benefit
In addition, nanobodies have also shown some potential in the treatment of myeloma, but there is not yet enough clinical data to confirm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of nanobody against B cell maturation antigen and its application
  • A kind of nanobody against B cell maturation antigen and its application
  • A kind of nanobody against B cell maturation antigen and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] This example is used for the construction and panning of phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0064] (1) Construction of phage nanobody library

[0065] Bactrian camels were immunized with BCMA-Fc expressing the extracellular region, and after ELISA was used to verify the titer, 200 mL of peripheral blood was drawn; lymphocytes were sorted to obtain peripheral blood mononuclear lymphocyte precipitates, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; insert the VHH gene into the pMECS phage display vector, and after electroporation into TG1 competent cells, take an appropriate amount of bacterial liquid for library identification , all the remaining cultures were evenly spread on the LB / AMPGLU plate. After the bacteria grew out, the bacterial lawn was collected, and 1 / 3 volume of 50% glycerol was...

Embodiment 2

[0079] In this example, a flow cytometric fluorescence sorting technology (Fluorescence activated CellSorting, FACS) was used to screen candidate clones.

[0080] Cells were cultured according to standard cell culture protocols, and cells were digested with trypsin to prepare BCMA-positive and negative cell suspensions; centrifuged at 300 g for 5 min to remove the culture medium, and resuspended cells to 2 × 10 in Flow Buffer. 6 cells / mL; add 2 x 10 to each well in a V-bottom 96-well plate 5 Cells were centrifuged at 300g for 5min, the supernatant was removed, the crude VHH antibody extract was added to resuspend the cells, and the cells were incubated at 4°C for 1h;

[0081] After centrifuging at 300g for 5 min, remove the supernatant, resuspend the cells in Flow Buffer, dilute APCanti-his antibody to 2 μg / mL with Flow Buffer, resuspend cells in 100 μL per well, and incubate at 4°C for 1 h; Wash cells with Flow Buffer for 3 times and then use 200 μL Flow Buffer Cells were resu...

Embodiment 3

[0083] In this example, the VHH-mIgG2a Fc nanobody was expressed and purified, and the antibody affinity was determined. In order to further identify the antibodies obtained by screening, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was constructed first, which is denoted as C-4 pCP.Stuffer-mCg2a-FC. The specific steps are as follows:

[0084] 1. Amplify BCMA VHH B12 by PCR with primers:

[0085] HDB12-F (SEQ ID NO. 10):

[0086] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTTGCAGCTGGTGGA;

[0087] HD-B12-R (SEQ ID NO. 11):

[0088] GCATGGAGGACAGGGCTTGATTGTGGGGCTGCTCACGGTCACCTG

[0089] The reaction system is shown in Table 2, and the amplification procedure is shown in Table 3 below:

[0090] Table 2

[0091]

[0092] table 3

[0093]

[0094] 2. The digestion system is shown in Table 4. The digestion temperature is 37°C and the time is 6h. The PCR purification kit was used for purification, and the reco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a nanobody against B cell maturation antigen and its application. The anti-B cell maturation antigen nanobody is BCMA-12, and the heavy chain variable region of the BCMA-12 includes: complementarity determining region 1 shown in SEQ ID NO.1, complementarity determining region 1 shown in SEQ ID NO.2 Determining region 2 and complementarity determining region 3 shown in SEQ ID NO.3. In the present invention, the antibody screened by the phage display nanobody library has a specific CDR region, and the obtained antibody can specifically bind to the BCMA antigen with good affinity; it is used as the antigen binding domain to construct a chimeric antigen receptor and CAR-T It has obvious killing activity to BCMA-positive tumor cells. Therefore, the nanobody has broad application prospects in the immunotherapy of multiple myeloma.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a nanobody against B cell maturation antigen and its application. Background technique [0002] Through genetic engineering technology, T cells are activated and carry tumor chimeric antigen receptor (CAR) to obtain chimeric antigen receptor modified T lymphocytes (Chimeric antigen receptor T cells, CAR-T), and CAR-T cells specifically recognize In vivo tumor cells, and release a variety of effectors through immune action, effectively kill tumor cells, so as to achieve the purpose of treating malignant tumors. Since the development of CAR-T cells, scientists have continued to try and optimize them. In recent years, CAR-T therapy has developed rapidly. Among them, CD19 (B lymphocyte antigen CD19, CD19) targeted CAR-T cells are used for relapse / refractory chronic B lymphocytic leukemia clinical research, and achieved amazing results. [0003] Chimeric antigen re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/28C07K19/00C12N15/13C12N15/867C12N7/01C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C12N15/86A61K39/0011A61P35/00C07K2317/22C07K2317/565C07K2317/567C07K2317/569C07K2317/92C07K2319/02C07K2319/03C07K2319/33C12N2740/15021C12N2740/15043
Inventor 狄升蒙童东阳茅健
Owner HUADAO SHANGHAI BIOPHARMA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More