Unlock instant, AI-driven research and patent intelligence for your innovation.

Composite PCR typing kit for distinguishing three streptococcus suis serotypes and application of composite PCR typing kit

A Streptococcus suis, kit technology, applied in microorganism-based methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of cumbersome operation, low sensitivity, poor specificity, etc., and achieve high sensitivity and false positive. Low, easy-to-use effect

Inactive Publication Date: 2021-09-24
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to cumbersome operation, long cycle, or low sensitivity and poor specificity, it cannot meet the needs of clinical testing.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composite PCR typing kit for distinguishing three streptococcus suis serotypes and application of composite PCR typing kit
  • Composite PCR typing kit for distinguishing three streptococcus suis serotypes and application of composite PCR typing kit
  • Composite PCR typing kit for distinguishing three streptococcus suis serotypes and application of composite PCR typing kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] A kind of composite PCR typing kit for distinguishing three kinds of Streptococcus suis serotypes, described kit comprises primer set; Described primer set is:

[0028] P1: TGATAGTGATTTGTCGGGAGGG; P2: GAGTATCTAAAGAATGCCTATTG;

[0029] P3: AGCTCTAACACGAAATAAGGC; P4: GTCAAACACCCCTGGATAGCCG;

[0030] P5: TTGGTGAGATTAAATCTAGAAAAG; P6: AGCCCTTATTGTCCTCAAAT.

Embodiment 2

[0032] The application of a composite PCR typing kit for distinguishing three serotypes of Streptococcus suis in distinguishing Streptococcus suis type 2, Streptococcus suis type 7 and Streptococcus equi zooepidemic subspecies is as follows:

[0033] (1) Preparation of composite PCR template: ① For clinical tissue samples, pick tissue samples with a serious lesion of about 1 cm and use sterile ddH 2 O for washing, boiled for 5-10 minutes, ice-bathed for 3 minutes, centrifuged at 12000r / min for 1 minute, and the supernatant was the template for the multiplex PCR reaction. ② For strains, use an inoculation loop that has been burned and cooled to room temperature on a sterile operating table to scrape an appropriate amount of freeze-dried powder or bacterial solution from the ampoule of freeze-dried or glycerin-preserved Streptococcus suis and spread it on TSA culture After culturing overnight, use an inoculation loop to pick out a single colony that is round, neat in edge, and g...

Embodiment 3

[0040] Clinical application of a composite PCR typing kit for distinguishing three serotypes of Streptococcus suis:

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biotechnology, and particularly relates to a composite PCR typing kit for distinguishing three streptococcus suis serotypes and application of the composite PCR typing kit. The kit comprises primer groups as follows: P1:TGATAGTGATTTGTCGGGAGGG, P2:GAGTATCTAAAGAATGCCTATTG; P3:AGCTCTAACACGAAATAAGGC, P4:GTCAAACACCCTGGATAGCCG; and P5:TTGGTGAGATTAAATCTAGAAAAG, P6:AGCCCTTATTGTCCTCAAAT. The composite PCR typing kit has very high accuracy and specificity in distinguishing three three streptococcus suis serotypes including Streptococcus suis serotype 2, Streptococcus suis serotype 7 and / or Streptococcus equisubsp.Zooepidemicus streptococcus, with the sensitivity reaching a pg level.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a composite PCR typing kit for distinguishing three serotypes of Streptococcus suis and an application thereof. Background technique [0002] Streptococcus suis is a bacterial infectious disease caused by a variety of pathogenic Streptococcus suis, the most important pathogenic bacteria of which is Streptococcus suis. Streptococcus suis can infect pigs and humans, causing acute hemorrhagic sepsis, meningitis, pneumonia, arthritis, etc., with high morbidity and mortality, which not only causes huge economic losses to the pig industry, but also poses a threat to human life safety . According to the difference of capsular polysaccharide, Streptococcus suis can be divided into 35 serotypes, among which Streptococcus suis type 2 is considered to be the most widely distributed and most pathogenic serotype. [0003] In recent years, with the rapid development of intensive pig ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/04C12N15/11C12R1/46
CPCC12Q1/689C12Q1/686
Inventor 高婷田永祥袁芳艳刘泽文刘威周丹娜杨克礼段正赢郭锐梁婉
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI