A novel anti-tumor switch receptor T cell
An anti-tumor, receptor-based technology, applied in the field of anti-tumor transformation of recipient T cells, can solve problems such as death, limited clinical efficacy of antibody drugs, and limited number of T cells, and achieve the effect of shortening length, enhancing activity and proliferation ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1. Preparation of anti-tumor conversion receptor T cells
[0048] 1. Construction of lentivirus
[0049] 1. Construction of Lentiviral Vector Plasmids
[0050] 1.1 Design PD-L1 antibody gene sequence
[0051] There are 4 items in total:
[0052] The first PD-L1 antibody gene sequence (SEQ ID NO.1):
[0053] CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGGCTGGGGGGTCTCTGAGACTCTCCTGTGTAGCCTCTGGAAGTATCAGCAGTTTCGACGCAGTGCTCTGGTACCGCCGGGCTCCAGGGAAGCAGCGCGATTGGGTCGCAACTTCTTTTACCGCCGGTCACACAATCTATGAAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAGGAACACGGTGTATCTGCAAATGAACAGCCTGAAAACTGAGGACACAGGCGACTATTATTGTAATGCGAGGCGACTAGGTGCGCACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGAACCCAAGACACCAAAACCACAAGAC
[0054] The second PD-L1 antibody gene sequence (SEQ ID NO.2):
[0055]GAGGTGCAGCTGGTGGAGTCCGGAGGAGGACTGGTGCAGCCTGGCGGCTCCCTGAGACTGAGCTGCGTGGCTAGCGGCTCTCATCTTAGCTTCGACGCCGTGCTGTGGTACAGGCAGGCTCCTGGCAAGCAGCGGGATTGGGTGGCCACCAGCTTCACAGCTGGCTATACTATCTACGAGGACTCTGTGAAGGGCAGGTTCACCATCTCCCGCGATAA...
experiment example 1
[0096] Experimental example 1. Detection of infection efficiency of αPDL1 / CD28 T cells
[0097] 1. Cell Preparation
[0098] αPDL1 / CD28 T cells, empty T cells (on the basis of Example 1, the αPD-L1-CD28 gene fragment was omitted, and the lentivirus empty vector was transferred), and control T cells.
[0099] 2. Antibody detection
[0100] Add biotinylated human PD-L1 protein with a final concentration of 1 μg / ml to each cell suspension, incubate on ice for 30 minutes in the dark, wash once with washing buffer, centrifuge at 300g for 5 minutes, remove the supernatant, Add 50 μl of streptavidin APC conjugate (Thermo Fisher Scientific, Cat. No. SA1005) diluted at 1:200 in PBS, mix well, and incubate on ice for 30 minutes in the dark. Wash once with wash buffer, centrifuge at 300 g for 5 minutes, remove the supernatant, and resuspend the cells in 200 μL of PBS buffer. The samples were analyzed by flow cytometry.
[0101] 3. Results
[0102] The result is as image 3 shown. ...
experiment example 2
[0105] Experimental example 2. Phenotypic analysis of activation state of αPDL1 / CD28 T cells
[0106] 1. Method
[0107] Prepare a 96-well plate and add 60 μl of coating solution to each well. The coating solution is composed of 1 μg / ml CD3 antibody (Miltenyi Company, Cat. No. 170-076-309) and / or 25 μg / ml PD-L1 protein (Sino Biological). Company, product number 10084-H05H), overnight at 4°C.
[0108] The lentivirus-infected T cells (ie αPDL1 / CD28 T cells), empty T cells, and control T cells obtained in Example 1 were seeded into each well, and the number of cells in each well was 2 × 10. 5 , cultured in a 37°C incubator.
[0109] After 24 hours, the cells in each well were collected, washed once with washing buffer, centrifuged at 300 g for 5 minutes, the supernatant was removed, and the cells were resuspended with 100 μL of washing buffer to obtain a cell suspension.
[0110] 1) Detection of CD69: Add 5 μL of PE-Cy7-labeled mouse anti-human CD69 mAb (purchased from BD Bios...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More