Replication type human adenovirus and application thereof

A human adenovirus, replicating technology, applied in the field of gene therapy, can solve the problems of lack of virus resources, lack of international recognition of clinical efficacy, and no oncolysis.

Pending Publication Date: 2021-12-10
GUANGZHOU N BIOMED LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2005, China approved the marketing of the world's first oncolytic adenovirus (H101), but the clinical efficacy has not yet been internationally recognized
Different viruses have complex biological characteristics, and virus resources that are fully familiar to humans are still relatively scarce
In particular, most of the preclinical experimental data come from human tumor transplantation models in immunodeficient animals, which are quite different from humans in terms of in vivo environment and biological characteristics of tissue cells.
There is no obvious commonality among existing oncolytic adenoviruses, and it is difficult to determine whether they have oncolytic effects based on the sequence of adenoviruses, but most adenoviruses are not sensitive to tumor cells and do not have oncolytic properties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Replication type human adenovirus and application thereof
  • Replication type human adenovirus and application thereof
  • Replication type human adenovirus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0077] A method for preparing a replicative human NBOV1901 oncolytic adenoviral vector, comprising the following steps:

[0078] S1) The left and right ends of the NBOV1901 genome were obtained by PCR amplification, connected to the ampicillin-resistant vector plasmid to obtain pT-NBOV1901 (L+R), and recombined with the NBOV1901 genome after linearization to obtain the genomic plasmid pNBOV1901;

[0079] S2) The right and left arms from SrfI to the entire E3 region were obtained by PCR amplification, connected to the kanamycin-resistant vector plasmid, and recombined with PacI-digested NBOV1901 after linearization to obtain the genomic plasmid pNBOV1901 from which SrfI was removed to the entire E3 region △E3-SrfI;

[0080] S3) Using the NBOV1901 genome as a template, the upstream fragment of E3gp19K was amplified by PCR: SrfI to E3gp19K, and the downstream fragment of E3gp19K: the region from E3gp19K to E3 contained the E3-14.7K gene fragment. The three fragments of the const...

Embodiment 1

[0107] Example 1: Circularization of the NBOV1901 genome

[0108] 1. Construction of the shuttle plasmid pT-NBOV1901(L+R) for circularizing the NBOV1901 genome.

[0109] refer to figure 1 A, Using the genome of NBOV1901 as a template, the left arm (L-NBOV1901) and the right arm (R-NBOV1901) of the NBOV1901 genome were obtained by PCR.

[0110] L-NBOV1901 primer:

[0111] L-NBOV1901-F: gcgggatccgaattcttaatgcgatcgccatcatcaataataatacccttat (SEQ ID NO.: 1)

[0112] L-NBOV1901-R: tatctgcatgagcatgatgatatcctttgacccggaacgcgg (SEQ ID NO.: 2)

[0113] PCR conditions: 95°C, 3min; 95°C, 30s; 60°C, 30s; 72°C, 30s; cycles 28; 72°C, 5min;

[0114] R-NBOV1901 primer:

[0115] R-NBOV1901-F: ccgcgttccgggtcaaaggatatcatcatgctcatgcagata (SEQ ID NO.: 3)

[0116] R-NBOV1901-R: gaagcgagatcgaattcttagcgatcgccatcatcaataaatacctta (SEQ ID NO.: 4)

[0117] PCR conditions: 95°C, 3min; 95°C, 30s; 60°C, 30s; 72°C, 1min; cycles 28; 72°C, 5min;

[0118] 2. Construction of pNBOV1901.

[0119] pT-NBOV190...

Embodiment 2

[0120] Example 2: Knockout of genes from SrfI to E3 region, construction of pNBOV1901ΔE3_SrfI plasmid

[0121]1. Construction of the shuttle plasmid pVax-ΔE3_SrfI(L+R) for gene knockout from SrfI to E3 region.

[0122] refer to figure 2 A, Using the genome of NBOV1901 as a template, the left arm (L-ΔE3_SrfI) and right arm (R-ΔE3_SrfI) of the gene from SrfI to E3 region were obtained by PCR.

[0123] L-ΔE3_SrfI primer:

[0124] L-ΔE3_SrfI-F: gatatacgcgtgtatac cttcccaggatggcaccca (SEQ ID NO.: 5)

[0125] L-ΔE3_SrfI-R: gtaagtaatttattgtgtgtgtttatg ttaattaa ctgtgtgaccgctgctgt (SEQ ID NO.: 6)

[0126] PCR conditions: 95°C, 3min; 95°C, 30s; 60°C, 30s; 72°C, 30s; cycles 28; 72°C, 5min;

[0127] R-ΔE3 primer:

[0128] R-ΔE3_SrfI-F: acagcagcggtcacacag ttaattaa cataaacacacaataaattacttac (SEQ ID NO.: 7)

[0129] R-ΔE3_SrfI-R: ccgcccagtagaagcgccggtg ccgcccgttttaatttccatgtt (SEQ ID NO.: 8)

[0130] PCR conditions: 95°C, 3min; 95°C, 30s; 60°C, 30s; 72°C, 50s; cycles 28; 72°C, 5min; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a replicative human adenovirus and application thereof. The complete sequence of the vector is as shown in SEQ ID NO.: 21. After loading related nucleotide sequences, the replicative human adenovirus disclosed by some examples of the invention can be directly injected into solid tumors including but not limited to H1299, Skov-3, U251 and other tumors, and through identification, the adenovirus not only can be replicated in tumor cells and can directly kill the tumor cells, but also can be directly injected into the solid tumors. After the infected tumor cells are cracked, peripheral tumor cells are infected; meanwhile, the replicative human adenovirus has no killing effect on normal human cells and has an unexpected oncolytic effect.

Description

technical field [0001] The invention relates to the field of gene therapy, in particular to a recombinant oncolytic adenovirus, a recombinant oncolytic adenovirus vector for preparing the recombinant oncolytic adenovirus and applications thereof. Background technique [0002] Cancer is caused by its own factors (genetic mutations, natural aging, etc.) or environmental factors (such as smoking, ultraviolet radiation, chemical substances, viral infections, etc.). According to the WHO report, tumors are currently the second leading cause of death in the world after cardiovascular diseases, and nearly 1 / 6 of global deaths are caused by cancer. In 2018, the global cancer death toll reached 9.6 million. It is estimated that by 2025, the annual number of new cancer cases worldwide will reach 24.49 million. Among them, lung cancer has the highest number of deaths, followed by colorectal cancer, stomach cancer, liver cancer and breast cancer. [0003] The classic methods of treati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/01C12N15/861A61K45/06A61K35/761A61K48/00A61K49/00A61P35/00A61P35/04C12R1/93
CPCC12N7/00C12N15/86A61K45/06A61K35/761A61K48/0008A61K49/005A61P35/00A61P35/04C12N2710/10321C12N2710/10343C12N2710/10332C12N2710/10352A61K2300/00A61K49/00A61K48/00C12N15/861
Inventor陈凌关素华刘波
OwnerGUANGZHOU N BIOMED LTD