Application of gene-enhanced immune cells in lung cancer
An immune cell, enhanced technology, applied in the field of immunology, can solve the problems of insufficient killing ability and difficult expansion of NK cells, and achieve the effect of enhancing killing activity and improving proliferation ability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] siRNA of lnc-AL592494.1 promotes NK cell proliferation
[0023] (1) Design the siRNA of lnc-AL592494.1 according to the cDNA sequence SEQ ID NO.1 of lnc-AL592494.1. The designed sequence of si-lnc-AL592494.1 is as follows:
[0024] The sense strand sequence of si-lnc-AL592494.1 is: AUUACAUAUGUAACAAUAC, SEQ ID NO.2;
[0025] The antisense strand sequence of si-lnc-AL592494.1 is: GUAUUGUUACAUAUGUAAU, SEQ ID NO.3;
[0026] (2) si-NC and si-lnc-AL592494.1 were transfected into NK-92 cells,
[0027] (3) After 48h of transfection, extract RNA to detect the expression of lnc-AL592494.1. The primer sequences are as follows:
[0028] Upstream primer: TCACGCATTCATGATTCACTGA, SEQ ID NO.4;
[0029] Downstream primer: TTGCTGGCCTATGGAATGCA, SEQ ID NO.5;
[0030] (4) The transfected NK cells were prepared into a cell suspension and seeded in a cell culture plate, with 500 cells per well, and 5 duplicate wells were set for si-NC and si-lnc-AL592494.1 respectively;
[0031] (5) Aft...
Embodiment 2
[0036] siRNA of lnc-AL592494.1 promotes GraB (granzyme B) and PFP (perforin) expression in NK cells
[0037] 1. Protein extraction
[0038] (1) Collect NK cells after transfection 48 into a centrifuge tube, remove the medium by centrifugation, wash with PBS, and add protein lysate;
[0039] (2) After fully lysing for 30 minutes, centrifuge the centrifuge tube in a centrifuge, and suck the supernatant into a new centrifuge tube;
[0040] (3) Refer to the instructions of the BCA protein concentration detection kit to detect the protein concentration, add the loading buffer to adjust to a uniform concentration, and then put the protein sample into boiling water and cook for 5 minutes to obtain the final protein sample;
[0041] 2. Western blot detection
[0042] (1) Configure electrophoresis gel, install electrophoresis rack, spot protein samples and protein markers, turn on the electrophoresis instrument and adjust it to a constant voltage of 90V for electrophoresis;
[0043]...
Embodiment 3
[0049] siRNA of lnc-AL592494.1 promotes the killing activity of NK cells against lung cancer cell A549
[0050] (1) NK cells transfected with si-NC and si-lnc-AL592494.1 were prepared into 2 × 10 6 / ml of cell suspension as effector cells;
[0051] (2) Duplicate lung cancer A549 cells into 2×10 cells 5 / ml of cell suspension as target cells;
[0052] (3) Mix 1.5ml of A549 cells with 1.5ml of si-NC cells and 1.5ml of si-lnc-AL592494.1 cells;
[0053] (4) Simultaneously set the effector cell and target cell natural release hole, the target cell maximum release hole and the medium natural release hole;
[0054](4) After mixing, the cells were cultured in a cell incubator for 4 hours, then centrifuged in a centrifuge for 10 minutes, and the supernatant was collected;
[0055] (5) After the end, suck 50ul of LDH enzyme reaction solution and 50ul of supernatant into each well and add it to the 96-well plate. After 30min reaction at room temperature in the dark, add 50ul of react...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


