Anti-human CD38 humanized monoclonal antibody and application thereof

A monoclonal antibody and variant technology, applied in the field of biomedicine, can solve the problems of complex production process of ADC products, poor stability, high maturity of BCMA targets, and achieve good thermal stability and solution stability, less impurities, and more. Beneficial for mass production and application

Active Publication Date: 2022-02-22
REYOUNG SUZHOU BIOLOGY SCI & TECH CO LTD
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, the off-target effect of CAR-T products, excessive activation of T cells, induction of cytokine release syndrome and neurotoxicity; the production process of ADC products is complex, the stability of molecules in vivo is poor, and the off-target toxicity of small molecules; the maturity of BCMA targets Not as high as CD38 target

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-human CD38 humanized monoclonal antibody and application thereof
  • Anti-human CD38 humanized monoclonal antibody and application thereof
  • Anti-human CD38 humanized monoclonal antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1 monoclonal antibody preparation

[0080] The DNA nucleotide sequence of the heavy chain of RB0021-S1 is:

[0081] CAAGTGACACTGAAAGAGAGCGGCCCTACACTGGTGAAGCCCACCCAGACACTGACACTGACATGCACCACCAGCGGCTACACATTCACCTCCCACGGCATCAACTGGGTGAGACAGCCCCCCGGCAAGGCCCTCGAGTGGATCGGCTACATCTACATCGGCAACGGCTACACCGAGTACAACGAGAAGTTCAAGGGAAGAGCTACACTGACCAGCGACACCAGCAAGAATCAAGCCGTGCTGACCATGACCAACATGGACCCCGTGGATACCGCCACCTACTTCTGCGCTAGATCCCACTACGACAGCTCCAGCTGGTTTGCTTACTGGGGCCAAGGCACACTGGTGACCGTGAGCTCCGCCAGCACCAAGGGACCTAGCGTGTTTCCTCTGGCCCCTTCTAGCAAGAGCACAAGCGGAGGAACAGCCGCTCTGGGCTGTCTGGTGAAAGACTACTTTCCCGAGCCCGTGACCGTGTCTTGGAATTCAGGAGCCCTGACCAGCGGAGTGCACACATTTCCAGCCGTGCTGCAGAGCAGCGGACTGTATAGCCTGAGCAGCGTGGTGACCGTGCCTTCTTCTTCTCTGGGCACCCAGACCTACATCTGCAACGTGAACCACAAGCCCAGCAACACCAAGGTGGACAAGAAGGTGGAGCCCAAGTCTTGCGACAAGACCCACACTTGCCCCCCTTGTCCAGCTCCAGAACTCCTGGGAGGACCTAGCGTGTTCCTGTTCCCTCCCAAGCCTAAGGACACCCTGATGATCAGCCGGACCCCAGAAGTGACTTGCGTGGTGGTGGACGTGTCCCACGAAGACCCCGAGGTCAAGTTCAATTGGTACGTGGACGGAGTGGAGG...

Embodiment 2

[0093] Embodiment 2 Purification and detection of monoclonal antibody

[0094] 1. Affinity chromatography

[0095] Flush the system with 0.5M NaOH, flush the filler Mabselect Sure with 0.1M NaOH, and control endotoxin for 1 hour each, and balance the filler with 20mM PB, 150mM NaCl (PH7.2). Filter the RB0021 PC (Daratumumab), RB0021-S1, RB0021-S2, RB0021-S3, RB0021-S4 transient expression supernatant and load the sample at a flow rate of 1mL / min. After loading, wash with 20mM PB and 150mM NaCl To the level of UV280 peak change, then washed with 20mM PB, 1M NaCl (PH6.5) to the level of peak change, finally eluted with 20mM Cit-Na3Cit (PH3.5), and neutralized with 1M Tris (PH9.0).

[0096] 2. Cation chromatography

[0097] Flush the system with 0.5M NaOH, flush the filler SP-HP with 0.1M NaOH, treat each for 2 hours to control endotoxin, and use 20mMPB (pH6.0) to balance the filler. Adjust the pH of the RB0021 PC (Daratumumab), RB0021-S1, RB0021-S2, RB0021-S3, and RB0021-S4 s...

Embodiment 3

[0110] Example 3 Monoclonal Antibody Affinity Determination

[0111] Biacore affinity determination was carried out with GE 8K, and HBS-EP+ was used as the experimental buffer at 25°C. The ligand was diluted to 5 μg / mL and immobilized on the Protein A chip at a flow rate of 10 μL / min for 20 seconds. The analyte CD38 was diluted to 0, 0.111, 0.333, 1, 3, 9 (×3), 27, 81nM with a flow rate of 30 μL / min, combined for 300 s, dissociated for 300 s, and regenerated with 10 mM Glycine-HCl (pH 1.5) at a flow rate of 100 μL / min min, time 30s, repeat once. Determination of affinity data is shown in Table 4 below:

[0112] Table 4 Affinity data

[0113] Antibody affinity (human) RB0021 PC (Daratumumab) 8.86E-08 RB0021-S1 1.17E-09 RB0021-S2 1.17E-09 RB0021-S3 1.04E-09 RB0021-S4 1.04E-09

[0114] It can be known from the above table 4 that the monoclonal antibody of the present invention can specifically recognize human CD38 protein, and its ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a monoclonal antibody combined with a CD38 antigen and application of the monoclonal antibody. The humanized monoclonal antibody provided by the invention can specifically recognize a CD38 antigen, has relatively good affinity, and also has antibody-dependent cell-mediated cytotoxicity (ADCC) activity and complement-dependent cytotoxicity (CDC) activity, so that CD38 + cells are killed. The invention also provides application of the monoclonal antibody or the variant in prevention and / or treatment of tumors.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a humanized monoclonal antibody binding to human CD38 protein and its application. Background technique [0002] Multiple myeloma (MM) is a malignant blood tumor with abnormal proliferation of plasma cells, which can affect the production of white blood cells, red blood cells, and stem cells in the bone marrow, causing anemia; destroying bone, damaging bones and soft tissues; causing repeated infections, Symptoms of renal insufficiency. Its incidence is increasing year by year. In 2019, the global incidence of multiple myeloma accounted for 1.8% of all tumors, accounting for 10%-15% of hematological tumors, ranking second in hematological tumors. As people's understanding of multiple myeloma continues to deepen, research and development efforts continue to increase, and new drugs, diagnostics, and treatment methods are becoming more and more abundant, especially immunomodu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C12N15/13A61K39/395A61P37/02A61P35/00A61P19/02A61P29/00A61P7/06A61P19/08A61P25/00A61P17/06A61P1/00A61P13/12A61P11/06
CPCC07K16/2896A61P37/02A61P35/00A61P19/02A61P29/00A61P7/06A61P19/08A61P25/00A61P17/06A61P1/00A61P13/12A61P11/06C07K2317/51C07K2317/732C07K2317/734C07K2317/92C07K2317/94A61K2039/505
Inventor万云超胡琛霏杨冬美崔文俊
OwnerREYOUNG SUZHOU BIOLOGY SCI & TECH CO LTD