Novel coronavirus rapid PCR detection primer group, detection device and application thereof
A detection device and a technology for detecting primers, which are applied in biochemical cleaning devices, enzymology/microbiology devices, bioreactor/fermenter combinations, etc., can solve the problems of complex, bulky, and expensive precise temperature control modules. Achieve the effect of rapid screening, simple device structure and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] A novel coronavirus rapid PCR detection primer, including five primers F3, B3, FIP, BIP, and Loop B, wherein F3 is a forward outer primer, B3 is a reverse outer primer, FIP is a forward inner primer, and BIP is a reverse primer Internal primers, Loop B is a loop-forming primer, and the nucleotide sequences of each primer are as follows:
[0037] F3: CGGCATGGTCAAAGCCTCTTC,
[0038] B3: TTCGGCTCTCAAAGCTGGTTCAA,
[0039] FIP: TCCCCTACTGCTGCATCTGGAGCGTTCCTCATCACGTAGTCG,
[0040] BIP: TTCTCCTGCTATCGAATGGCTGGCTCTGTCAAGCAGCAGCAAAG,
[0041] Loop B: AATGGCGGCTTGATGCTGCTCTCT.
[0042]According to the above-mentioned rapid PCR detection primers for the new coronavirus, the present invention also provides a rapid PCR detection kit for the new coronavirus, which is used to detect the new coronavirus using the above-mentioned rapid PCR detection primers for the new coronavirus. The kit includes sampling swab 81, PCR reagent tube 9, lysate test tube 83, LAMP reaction solution tes...
Embodiment 2
[0052] Such as Figure 4 to Figure 7 Shown, a kind of virus PCR rapid detection device of the present invention, this detection device uses the test kit in embodiment 1 and new coronavirus rapid PCR detection primer. The virus PCR rapid detection device comprises a packing box 1, an upper cover plate 5, a PCR reagent tube base 7, a PCR reagent tube hole groove 8, an upper cover heating module 11 and a base heating module 12, and the PCR reagent tube base 7 is installed in the package In the box 1, multiple rows of PCR reagent tube hole grooves 8 are vertically arranged on the PCR reagent tube base 7, and the number of PCR reagent tube hole grooves 8 is at least 20, and 20 are arranged in the present embodiment. The rear part can be opened and closed with an upper cover plate 5, and the upper cover plate 5 is closed on the packaging box 1 to form a closed box body. An upper cover heating module 11 is installed on the lower part of the upper cover plate 5, and a PCR reagent tube...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com