Method for improving expression quantity of 5-aminolevulinic acid
A technology of aminolevulinic acid and expression, applied in the field of genetic engineering, can solve the problems of host cell metabolic imbalance and reduce the synthesis level of target products, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] 1. pykA Plasmid construction for overexpression
[0023] 1.1 pykA codon optimization
[0024] optimization pykA sequence, filtered to pykA 2 new sequences of , named as pykA1, pykA2, and synthesized.
[0025] 1.2 pykA Construction of overexpression elements
[0026] by C. glutamicum ATCC 13032 chromosome as template, 2 pairs of primers (P tuf -F:5- GTTCCTGGGCTTT GAGCA TGGCCGTTACCCTGCGA-3 and P tuf -R:5- TGCTTAATTAATGCTGAGATGTTTAAACCAT TGTATGTCCTCCTGGACTTC-3,T sod -F: 5- GTTTAAACATCTCAGCATTAATTAA GCATTTTTTAGTACGTGCAATAACC-3 and T sod -R: 5-GCCCATCCGTAAATTCTCGCTTGCCACAGCTGGCCT-3 respectively amplifies the strong promoter P tuf , terminator T sod , the PCR products were named as P tuf , T sod 。 with P tuf -F and T sod -R is a primer, and the PCR product P is generated by Overlap-PCR tuf , T sod Fusion is carried out to obtain the expression cassette P for overexpression of foreign genes tuf / T sod .
[0027] 2. wxya Construction of ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com