Novel mutant protein for improving malic acid yield

A mutant protein, malic acid technology, applied in the biological field, can solve problems such as cell burden

Active Publication Date: 2020-04-28
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these works mainly try to construct malate synthesis pathways in different species and perform partial optimization, such as selecting promoters with different strengths to express key enzymes in malate synthesis to improve malate synthesis ability, but this requires a multi-round combination process And overexpression of key synthetic enzymes will also cause additional burden on cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel mutant protein for improving malic acid yield
  • Novel mutant protein for improving malic acid yield
  • Novel mutant protein for improving malic acid yield

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0194] Preparation of mutant proteins

[0195] The present invention also provides a method for preparing the pyruvate carboxylase mutant protein malate transporter mutant protein, comprising culturing the host cell of the present invention under suitable expression conditions, thereby expressing the pyruvate carboxylase mutant protein and / or the the malate transporter mutein; and

[0196] The pyruvate carboxylase mutein and / or the malate transporter mutein are isolated.

[0197] The mutein obtained may also optionally be purified to obtain a more pure mutein product.

[0198] Preferably, the conditions suitable for expression include conventional techniques in the art, and purification techniques include nickel column purification, ion exchange chromatography, and the like.

[0199] carbon source

[0200] The carbon source that can be used in the present invention is not particularly limited, it is a type of nutrient for the growth of microorganisms (such as the host cell ...

Embodiment 1

[0209] Example 1 Pichia pastoris dicarboxylic acid transporter screening platform construction

[0210] 1. Construction of vectors for overexpressing pyruvate carboxylase and malate dehydrogenase in Pichia pastoris:

[0211] Use primers AvrII-F (SEQ ID NO: 44): (CCACCGCCCGTTACCGTCCGAAGGAAATTTTACTCTGCTGGAG) and AvrII-R (SEQ ID NO: 45): (CTCCAGCAGAGTAAAATTTCCTTCGGACGGTAACGGGCGGTGG) to perform PCR with pGAPzA as a template. The PCR reaction system is: 5×phusion HF buffer 10 μl 10 mM dNTPs 1 μl, AvrII-F 1 μl, AvrII-R 1 μl, pGAPzA 1 μl, Phusion DNA polymerase 0.5 μl, water 35.5 μl. The PCR reaction conditions are as follows: first 98°C for 30s; then 98°C for 10s, 60°C for 30s, 72°C for 3min, 30 cycles; finally 72°C for 10min, 4°C for 10min. After the PCR reaction, the product was purified through a purification column, and 1 μg of plasmid was added to 1 μl of restriction endonuclease DpnI to digest and remove the template, and then heat inactivated at 85°C for 5 minutes, and 5 μl ...

Embodiment 2

[0222] Example 2 Construction and screening of dibasic carboxylic acid transporter mutation library.

[0223] 1. Construction of expression vector of dicarboxylic acid transporter:

[0224] Primers are:

[0225] Hph‐BamH1 SEQ ID NO:50GGGGGATCCTGTACAGCTTGCCTCGTCCCC

[0226] Hph‐R SEQ ID NO:51GTCGACACTGGATGGCGGCGTTAG

[0227] Using the pAG34 plasmid as a template, the hygromycin gene was amplified by PCR. The PCR reaction conditions were: first 98°C for 30s; then 98°C for 10s, 60°C for 30s, 72°C for 2min, 30 cycles; finally 72°C for 10min, 4°C for 10min. After the PCR reaction, the product was purified through a purification column, digested with BamH1, and connected to the pGAPzA plasmid digested with BamH1 and EcoRV, and the ligated product was transformed into E. coli competent cell DH5α. The monoclonal sequencing was correct, and pGAP-hph was obtained .

[0228] Primers are:

[0229] his‐BglII SEQ ID NO:52GGGAGATCTGTTGTAACACTGGCAGAGCATTACG

[0230] his‐BamH1 SEQ ID NO:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a novel mutant protein for improving malic acid yield. Specifically, the invention provides a novel pyruvate carboxylase mutant protein and malic acid transporter mutant proteinor a combination thereof, and a preparation method and application thereof in improving malic acid yield.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to a new mutant protein of pyruvate carboxylase and malate transporter in malic acid synthesis pathway and application thereof. Background technique [0002] Malic acid (2-hydroxy-1,4-butanedioic acid) is an important platform compound widely used in pharmaceutical, cosmetic, food and beverage industries. The previous synthesis mainly used chemical methods, but the process produced mainly a mixture of D and L-malic acid, which was difficult to separate. [0003] There are currently five main pathways reported for malic acid synthesis, namely TCA cycle, reduced TCA (or reverse TCA) rTCA, cyclic glyoxylate cycle and non-cyclic glyoxylate cycle, and relying on malic enzyme reverse catalysis Pyruvate directly synthesizes malic acid. Among them, the rTCA cycle and the malic enzyme pathway are the most effective, and the theoretical conversion rate of glucose to malic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/00C07K14/415C12N15/29C12P7/46
CPCC12N9/93C12Y604/01001C07K14/415C12P7/46C07K14/38C07K14/39C12R2001/865C12R2001/645C07K14/37
Inventor田朝光赵军旗李金根张路
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI