Dihydrolipoic acid dehydrogenase mutant P213R and application thereof in synthesis of poly-gamma-glutamic acid of bacillus licheniformis

A technology of Bacillus licheniformis and dihydrolipoic acid, which is applied in the fields of enzyme engineering and genetic engineering

Active Publication Date: 2020-02-28
HUBEI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the relationship between the expression level and expression activity of pyruvate dehydrogenase and dihydrolipoic acid dehydrogenase and the synthesis level of poly-γ-glutamic acid has not been studied. Can the targeted modification of dihydrolipoic acid dehydrogenase be possible? Increased levels of poly-γ-glutamic acid synthesis are also unpredictable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dihydrolipoic acid dehydrogenase mutant P213R and application thereof in synthesis of poly-gamma-glutamic acid of bacillus licheniformis
  • Dihydrolipoic acid dehydrogenase mutant P213R and application thereof in synthesis of poly-gamma-glutamic acid of bacillus licheniformis
  • Dihydrolipoic acid dehydrogenase mutant P213R and application thereof in synthesis of poly-gamma-glutamic acid of bacillus licheniformis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Construction of Bacillus licheniformis WX-P213R with mutation of dihydrolipoic acid dehydrogenase gene:

[0030] 1. The dihydrolipoic acid dehydrogenase gene P213R (shown in SEQ ID NO.2) mutated through gene synthesis sequence according to the genomic DNA sequence of Bacillus licheniformis WX-02; using the genomic DNA of Bacillus licheniformis WX-02 as a template , PCR amplifies the upstream homology arm of the PdhD gene (primers are T2-F1 and T2-R1) and the downstream homology arm of the PdhD gene (primers are T2-F2 and T2-R2);

[0031] T2-F1:GACGACAATACAGATGAAGT

[0032] T2-R1: AAATCTCCTACTACCATTACATTACGCCTCCATTA

[0033] T2-F2: TAATGGAGGCGTAATGTAATGGTAGTAGGAGATTT

[0034] T2-R2: TAACAACGAAATAGTGGC 2. Connect the upstream homology arm of the PdhD gene, the dihydrolipoic acid dehydrogenase mutant P213R gene and the downstream homology arm of the PdhD gene by overlap extension PCR to form a target gene fragment. The arrangement order of the gene fragments is: the ups...

Embodiment 2

[0044] Application of dihydrolipoic acid dehydrogenase mutant strain WX-P213R in improving poly-γ-glutamic acid fermentation yield:

[0045] Fermentation Product Yield Analysis

[0046] The Bacillus licheniformis WX-P213R bacterial strain obtained in Example 1 was inoculated into LB medium, and cultivated for 14 hours at 37° C.; 50 mL of poly-γ-glutamic acid fermentation medium was loaded into a 500 mL Erlenmeyer flask, and then the seeds were cultured The bacterial solution is inoculated into the fermentation medium with an inoculum amount of 3% (volume percentage). The culture conditions are 230 r / min, 37° C., and 36 hours of fermentation period.

[0047] In this embodiment, for different fermentation medium formulations, the influence of Bacillus licheniformis WX-P213R on the synthesis level of poly-γ-glutamic acid was investigated (also inoculate Bacillus licheniformis WX with the same inoculum amount in these 24 kinds of media at the same time -02 as a contrast), 24 gro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and enzyme engineering, and discloses application of a dihydrolipoic acid dehydrogenase mutant P213R in synthesis of poly-gamma-glutamic acid of bacillus licheniformis. Through site-directed mutation on a genome, the 213rd proline-encoded basic group CCA of dihydrolipoic acid dehydrogenase PdhD derived from bacillus licheniformisWX-02 is modified as CGG, in other words, the 213rd site is changed from proline to arginine, so that the synthesis level of the poly-gamma-glutamic acid is remarkably increased, and the yield of themutant strain poly-gamma-glutamic acid is at least increased by more than 21% as compared with a control strain. A new strategy is provided for efficient production of the poly-gamma-glutamic acid.

Description

technical field [0001] The invention belongs to the technical fields of enzyme engineering and genetic engineering, and specifically relates to a dihydrolipoic acid dehydrogenase mutant P213R and its application in the synthesis of poly-γ-glutamic acid of Bacillus licheniformis. Background technique [0002] Poly-γ-glutamic acid (γ-PGA) is an anionic biopolymer, the force of intermolecular hydrogen bonds is provided by carboxyl groups, and has excellent properties such as adsorption, water solubility, and biodegradability. It is a good environment-friendly polymer material, which can be used as water-retaining agent, heavy metal ion adsorbent, flocculant, slow-release agent for pesticides and fertilizers, etc. Value. [0003] At present, the commercial production of poly-γ-glutamic acid mainly relies on microbial fermentation, but due to the need to add poly-γ-glutamic acid synthesis precursors and excessive fermentation by-products, the conversion of glucose to poly-γ-glut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/53C12P13/02C12N1/21C12R1/10
CPCC12N9/0051C12P13/02C12N1/20C12Y108/01004
Inventor陈守文张蒙蔡冬波杨帆陈耀中张清马昕
OwnerHUBEI UNIV