Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method and application of Italian bee body color differentiation related gene

An Italian honeybee and gene technology is applied in the field of detection of genes related to body color differentiation of Italian honeybee, which can solve the problem of no research report on Hymenoptera, shorten the experiment time, improve the sensitivity, and ensure the reliability and repeatability.

Pending Publication Date: 2021-10-19
SERICULTURAL RES INST ANHUI ACADEMY OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

BH 4 Anabolic networks have been studied in Drosophila melanogaster and silkworm in Lepidoptera, but there are almost no research reports in Hymenoptera.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and application of Italian bee body color differentiation related gene
  • Detection method and application of Italian bee body color differentiation related gene
  • Detection method and application of Italian bee body color differentiation related gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0040] 1. Acquisition of primers:

[0041] (1) Obtain the mRNA sequence list (SEQ ID NO.7) of Apis mellifera pterin-4-α-methanolamine dehydratase gene number LOC411607 through NCBI;

[0042] (2) Amel-PCD-like-F: TATGTCGATTCTTACGCG; Amel-PCD-like-R: TTTTCTTCCATTTTAGCAAT were used as primers to amplify the PCD of queen bee, worker bee and drone in Apis mellifera, and then sequenced to obtain AmPcd sequencing results (SEQ ID NO.8)

[0043] (3) Compare SEQ ID NO.7 and SEQ ID NO.8, and use the common part of the two as a template to design fluorescent quantitative primers as

[0044] Amel-PCD-QRT-F: CTGTGCAACAAGATAGAG;

[0045] Amel-PCD-QRT-R: CATTAACATCGTGAGAAG.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method and application of Italian bee body color differentiation related gene, and relates to the technical field of biology. The detected related gene is the gene of the Italian bee pteridin-4-alpha-methanol amine dehydratase, and the detection method mainly comprises the following steps: designing fluorescent quantitative primers Amel-PCD-QRT-F and Amel-PCD-QRT-R, extracting total RNA, synthesizing cDNA, carrying out real-time fluorescent PCR, and calculating gene expression. The defects in the prior art are overcome, a related reference index of the synthesis amount of BH4 in bees is established by detecting pteridin-4-alpha-methanol amine dehydratase PCD, and a theoretical basis is provided for the synthesis route of BH4 of Italian bees by researching the gene expression level of PCD of bees of various differentiation types in an Italian bee colony; and a certain reference is provided for researching a pigment metabolism network in a bee body.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the detection and application of genes related to body color differentiation of Italian honeybees. Background technique [0002] As an important economic insect, honeybees are widely distributed all over the world. There are about 70 million bee colonies in the world. They play an important role in crop pollination and have extremely high economic and ecological value. Bee products, such as honey, royal jelly, propolis, etc., are rare natural products to maintain human health, and have created considerable social and economic benefits. [0003] A bee colony is usually composed of three types of bee individuals of two sexes, namely queen bee, worker bee and drone. These three types of bees are collectively referred to as "three types of bees" in apiology. A bee colony consists of bees of both sexes, both female bees and male bees. Female bees develop from fertilized diploid eggs, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/686C12N15/11
CPCC12Q1/6888C12Q1/686C12Q2600/158C12Q2600/124C12Q2561/113C12Q2563/107C12Q2521/107
Inventor 舒蕊代君君刘健赵萍刘震
Owner SERICULTURAL RES INST ANHUI ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com