Detection method and application of Italian bee body color differentiation related gene
An Italian honeybee and gene technology is applied in the field of detection of genes related to body color differentiation of Italian honeybee, which can solve the problem of no research report on Hymenoptera, shorten the experiment time, improve the sensitivity, and ensure the reliability and repeatability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0040] 1. Acquisition of primers:
[0041] (1) Obtain the mRNA sequence list (SEQ ID NO.7) of Apis mellifera pterin-4-α-methanolamine dehydratase gene number LOC411607 through NCBI;
[0042] (2) Amel-PCD-like-F: TATGTCGATTCTTACGCG; Amel-PCD-like-R: TTTTCTTCCATTTTAGCAAT were used as primers to amplify the PCD of queen bee, worker bee and drone in Apis mellifera, and then sequenced to obtain AmPcd sequencing results (SEQ ID NO.8)
[0043] (3) Compare SEQ ID NO.7 and SEQ ID NO.8, and use the common part of the two as a template to design fluorescent quantitative primers as
[0044] Amel-PCD-QRT-F: CTGTGCAACAAGATAGAG;
[0045] Amel-PCD-QRT-R: CATTAACATCGTGAGAAG.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



