Detection kit for fragile X syndrome FMR1 gene
A gene detection and kit technology, applied in the field of Fragile X syndrome FMR1 gene detection kits, can solve the problems of cumbersome operation, low throughput, difficulty in amplifying PCR products of premutation carriers or full mutation patients, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] (1) PCR amplification primer design
[0028] Design a pair of specific PCR amplification primers within 150 bp of the upstream 5' end and downstream 3' end of the CGG repeat sequence of the FMR1 gene, the upstream primer FMR1-F and the downstream primer FMR1-R, to amplify the FMR1 gene region including the CGG repeat region, 5 'flanking region and 3'flanking region. The length of the amplified fragment is (221+3xn)bp, where n represents the number of CGG repeats.
[0029] FMR1-F: GCCCGCACTTCCACCACCAGCTCCTCCA;
[0030] FMR1-R:TCTGGACCCTGAAGTGTGCCGTTG;
[0031] (2) The third primer design
[0032] A third primer, FMR1-CGG, which is randomly anchored in the CGG repeat region of the FMR1 gene and combined with a pair of specific amplification primers to generate amplicons of different sizes is designed.
[0033] FMR1-CGG: TGAAGTGTGC CGTTGATACG GCGGCGGCGG CGG.
Embodiment 2
[0034] The preparation of embodiment 2 detection template
[0035] MagaBio Dried Blood Spot Genomic DNA Purification Kit (Hangzhou Bioer Technology Co., Ltd.) was used to extract high-quality and high-purity genomic DNA, and the specific operation process was carried out according to the instructions.
Embodiment 3
[0036] Example 3 Prepare PCR reaction components
[0037] The PCR reaction components are as follows: 10×PCR Buffer includes Tris-HCl and 500mmol / L KCl with a concentration of 100mmol / L and a pH value of 8.3; MgCl with a concentration of 25mmol / L; 5×Q-solution (QIAGE); 10mmol / L of dNTP; the upstream primer FMR1-F with a concentration of 10μmol / L; the downstream primer FMR1-R with a concentration of 10μmol / L; the third primer FMR1-CGG with a concentration of 10μmol / L; the activity of 5U / μL DNA Polymerase HotStarTaq DNA Polymerase (Thermo Scientific); 1×Taq Extender Additive (Merck); deionized water.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com